We narrowed to 820 results for: cell;
-
TypeBlog Post...really easy to clone genes for expression in plant cells. Sylvester and I chose the 96 most useful things...
-
Sequencing Primers
TypeGuide...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT... -
Transferable Skills Guide: Career Planning Resources
TypeBlog Post...attend. Societies, such as the American Society for Cell Biology (ASCB) or the American Chemical Society ... -
Career Insights: Technical Support Specialist
TypeBlog Post...issue was with a custom-made reagent to manipulate cells (manufactured by one of the larger biotech companies...Specifically, roles in technical support make excellent use of the skills developed by life science PhDs...about novel developments in the fields of gene and cellular therapies. Additional Resources on the Addgene... -
Magnetic Control of Proteins: More than a Dream
TypeBlog Post...visible whether expressed in E. coli, in mammalian cells, or in purified form, and didn’t need any added ... -
Droplet Digital PCR for AAV Quantitation
TypeBlog Post...used in the detection of rare sequences and single cell analysis. It is also being used in the detection... -
Deciphering the Mysteries of Behavior with Viral Vectors
TypeBlog Post...the mesocorticolimbic system in addiction. Front Cell Neurosci. 2014;8:466. PubMed PMID: 25653591. PubMed... -
Light Sheet Fluorescence Microscopy
TypeBlog Post... Weber, M. Mickoleit, J. Huisken. (2014) Methods Cell Biol.123, 193-215. Pubmed. W. Spalteholz. (1914)...transparent are enabling microscopes to visualize the cellular architecture of whole tissues in 3D with unprecedented... -
Trimmer Lab NeuroMab Collection
TypeCollection...R-mAbs plasmids, production of R-mAbs in transfected cells and their validation can be found below. With these...transfecting the plasmids into mammalian tissue culture cells (e.g., HEK293, COS, CHO), from which the R-mAbs ...level expression we recommend using the HEK-2936E cell line engineered by Durocher et al., 2002 (Link opens...used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target Target Species Host Species...Pink1 Human M. musculus (mouse) IgG2b 227033 SynCAM1 cell adhesion molecule (Mus musculus) recombinant mouse...used to produce scFvs from transfected mammalian cells. Addgene ID Plasmid Hybridoma Target Target Species...to produce nanobodies from transfected bacterial cells. Addgene ID Plasmid Hybridoma Target Target Species... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...Alternatively, gRNA-only plasmids can be used in cells or organisms in which Cas9 has been integrated into... -
Plasmids 101: Broad Host Range Plasmids
TypeBlog Post...ability to establish and maintain itself within host cells. The plasmid has multiple ori that are functionally...eutrophus, Bartonella bacilliformis, Bordetella spp., Brucella spp., Caulobacter crescentus, Escherichia coli... -
QC Sequencing Technologies at Addgene
TypeBlog Post...named) “nanopores” that are attached to the flow cell membrane and have an electrical current running ... -
Antibodies 101: Normalization and Loading Controls for Western Blots
TypeBlog Post...Most housekeeping proteins are highly expressed in cells. This means that at sample concentrations appropriate... -
Using Video to Share Your Science: We Share Science
TypeBlog Post... the 926 video abstracts identified. The journal Cell had the largest average view count per video abstract.../wesharescience.com/pin/7472 Article: http://www.cell.com/current-biology/abstract/S0960-9822(16)30873... -
CRISPR-mediated Plant Base Editors
TypeBlog Post...homology-directed repair (HDR) pathway which occurs in cells at low frequencies and relies on the efficient delivery...Later the resultant U-G pair is either repaired by cellular mismatch repair machinery making an original C-G...’ to ‘I’ (inosine), which is treated as ‘G’ by cellular polymerases. Subsequently, an original genomic... is converted to a G-C pair (Figure 1). As the cellular inosine excision repair is not as active as uracil... -
Optogenetics AAV Preps
TypeCollection...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics... -
Retrograde AAV viral preps
TypeCollection... of Cre, and expresses NLS-EGFP in Cre-positive cells. Control Brandon Harvey 137164 pAAV-nEF-Con/Fon/... -
The Pleiades Promoter Project
TypeCollection...therapies for brain disorders by enabling region- and cell-specific gene-delivery in the mouse brain through... -
Modular Cloning Guide
TypeGuide...assembly of cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can...MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete... create multigene constructs expressed in the cellulose-producing Komagataeibacter species. Ralstonia-... -
9 tips for a successful postdoctoral experience
TypeBlog Post... optimization of fluorescent proteins, and live cell imaging approaches. Erik is also an avid long distance...