Skip to main content
Addgene
Showing: 61 - 80 of 721 results

  1. CRISPR-based Genome Editing Systems For Editing in E. coli

    Type
    Blog Post
    ...Integration Using CRISPR-Associated Transposases. ACS Synth Biol 9:1998–2008. https://doi.org/10.1021/acssynbio...the cell. The edit in the chromosome can now take place. After editing, pTargetF can be cured from the cell... E. coli with the donor DNA for editing to take place. Then plasmids are cured from the cell. Steps 1-...involved the following changes. In pCas9, we 1) replaced the promoter of gRNA-pMB1 with PrhaB, 2) changed...counterselection to yield pEcCas. In pTargetF, we replaced the original 20 bp specific sequences on pTargetF...serves as a counterselection marker and will be replaced by the sgRNA targeting the genomic site of interest... clearance. It is more convenient to update the spacer(20nt) on pEcgRNA plasmid as only two 24 nt oligos...

  2. New Optogenetic Tools for Cytoskeleton and Membrane Control

    Type
    Blog Post
    ...Systems: The Rho-Family GTPase Signaling Toolbox. ACS Synthetic Biology, 11(1), 515–521. https://doi.org...and study a protein’s function at a very specific place and time. Future studies with these CIB1-Rabs in...

  3. Hot Biosensors 2022: Year-End Roundup

    Type
    Blog Post
    ...through Structure-Guided and Genome Mining Strategies. ACS Sens. 2022 May 27;7(5):1336-1346. doi: 10.1021/acssensors...sensor Ace2N and additional GCaMP6 constructs: pAAV-CAG-dLight1.2 (AAV1) pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST...fluorescence unit fused with TRansmembrane region-to-IntrAcellular loop linkers” (MTRIA for short), where a fluorescent...inserting a circularly-permuted GFP into an intracellular loop of various G-protein-coupled receptors....fluorescent sensor for real-time measurement of extracellular oxytocin dynamics in the brain. Nat Methods....  Find B-gTEMP plasmids here!   Lu K, et al. Intracellular Heat Transfer and Thermal Property Revealed ...

  5. Antibodies 101: The Basics of Western Blotting

    Type
    Blog Post
    ...Pillai-Kastoori L, Heaton S, Shiflett SD, Roberts AC, Solache A, Schutz-Geschwender AR (2019) Antibody...sample migrate through the stacking gel at the same pace and enter the resolving gel at the same time where...post-translational modifications such as phosphorylation, acetylation, methylation and ubiquitination. For example,...

  6. Genetic Code Expansion

    Type
    Collection
    ... Nε-acetyl-L-lysine Bacterial TAG David Liu 104071 pTECH-MmAcK3RS(IPYE) AcK3RS M. mazei Nε-acetyl-L-lysine...thermophila acetyl-lysine Mammalian Tao Liu 164081 pCMV-MfPylRS (human-opti) PylRS M. flavescens acetyl-lysine...thermophila acetyl-lysine Mammalian Tao Liu 164196 pCMV-MfBulKRS (human-opti) BulKRS M. flavescens acetyl-lysine...tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR). Expresses archaeal ...tyrTV gene replaced by tRNA variant that suppress the TAG nonsense codon, and tyrU gene replaced by tRNA ...tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR) and release factor 1...expressed from a plasmid containing a UAG codon at the place where the new amino acid would be incorporated. ...

  7. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...want to use double nickase, you could express two spacers and use PX335 to express the Cas9n (nickase). The...PAM sequence to the oligo when cloning my target spacers into the PX330 vector backbone? There is no need...usually adds it when they order the oligo. If your spacer sequence starts with a 'G', you naturally have ... compared to where the target site sequence (protospacer+PAM) is located? If there are other PAMs in the...only matter if the PAM sequence is immediately adjacent to the nearly-homologous target sites. The mere... there needs to be extensive homology of the protospacer followed by PAM. Click here for a target selection... together, with each plasmid having a targeting spacer cloned into the backbone ( pX330 or PX335 , depending...

  8. CRISPR Guide

    Type
    Collection
    ...The target is present immediately adjacent to a P rotospacer A djacent M otif (PAM) The PAM sequence (NGG...codons that make up a gene PAM P rotospacer A djacent M otif; Sequence adjacent to the target sequence that...referred to as CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeat) technologies. Before...for Cas-binding and a user-defined ∼20-nucleotide spacer that defines the genomic target to be modified....through interactions between the gRNA scaffold and surface-exposed positively-charged grooves on Cas9. gRNA... an active, DNA-binding configuration, with the spacer region of the gRNA left free to interact with the...Cas9 will only cleave a given locus if the gRNA spacer sequence shares sufficient homology with the target...

  9. COVID-19 Resources

    Type
    Collection
    ...membrane fusion function.( 5 ) TACE - (ADAM17) a metalloprotease that cleaves hACE2, potentially increasing ...Protein Upstream of Rather than Adjacent to the Fusion Peptide . TACE - Heurich A, et al , 2014, J Virol...cellular receptor for SARS-CoV-2 and SARS-CoV is hACE2, an angiotensin receptor. Another key step is the...Collection page. SARS-CoV-2 Pooled Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD...having a key role in coronavirus infection, such as ACE2 and TMPRSS2, which are involved in the entry of ...these genes, see the links and references below: ACE2 - (Human Angiotensin Converting Enzyme 2) is the... SARS-CoV-2 spike RBD and block interaction with ACE2. Huo, et al. Nat Struct Mol Biol. 2020 Jul 13. (...

  10. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ... cell surface localization 101131 pACP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization...used in live or fixed cells, and for internal or surface proteins Single constructs are compatible with ...agents) ACP- and MCP-tags are used exclusively for surface proteins and use enzymatic binding to attach substrate...are particularly well suited for labeling cell-surface proteins, and are useful for labeling secreted ...pSNAPf-ADRβ2 Control Plasmid SNAP-tag Control for cell surface localization 101136 pCLIP-tag (m) Vector CLIP-tag...pCLIPf-NK1R Control Plasmid CLIP-tag Control for cell surface localization 101127 pMCP-tag (m) Vector ACP/MCP-tag...pACP-ADRβ2 Control Plasmid ACP/MCP-tag Control for cell surface localization Supplemental Information SNAP and ...

  11. Chemogenetics Guide

    Type
    Guide
    ...Receptors Exclusively Activated by Designer Drugs. ACS Chem Neurosci. 6:476–484. PMID: 25587888 (Link opens...receptors, or GPCRs. The largest class of cell surface receptors, GPCRs are seven-pass transmembrane proteins...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently one ... was created by replacing the corresponding intracellular region of a turkey erythrocyte β-adrenergic ...pronounced SAMs). PSAMs are engineered α7 nicotinic acetylcholine receptor (nAChR) domains that respond to specific...

  12. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...of a 20-mer (“protospacer sequence”) upstream of an “NGG” sequence (“protospacer adjacent motif” or PAM...Abstract The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated...Figure 2A ). NOTE: In this example, sgRNA-A’s protospacer sequence and PAM happen to fall on the bottom...bottom (Crick) strand while sgRNA-B’s protospacer sequence and PAM fall on the top (Watson) strand ( Figure...will occur independent of orientation of the protospacer sequence/PAM relative to the top or bottom strand...However, if the first position of the 20-mer (protospacer sequence) is G, do not add another G ( e.g., ...samples on 2% agarose gel at 10 V/cm using 1x Tris-acetate-EDTA (TAE) buffer. Examine samples for the presence...

  13. Validated gRNA Sequences

    Type
    Collection
    ...lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....

  14. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Anti-Pan-Neurofascin (extracellular) [A12/18R] Pan-Neurofascin (extracellular) Rat Mouse IgG2a 177439...Anti-Kv1.4 K+ channel (extracellular) [L71/5R] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 177489...Mouse IgG2a 177564 Anti-ADAM22 (extracellular) [N57/2R] ADAM22 (extracellular) Mouse Mouse IgG2a 177565 Anti-GluN2B...Anti-Kv1.4 K+ channel (extracellular) [L71/22] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 190292...-Neurofascin (extracellular) scFv [A12/18] A12/18 scFv 2t Pan-Neurofascin (extracellular) Rat Mouse 190486...Kv1.4 K+ channel (extracellular) scFv [L71/5] L71/5 scFv Kv1.4 K+ channel (extracellular) Rat Mouse 190518... Mouse 190537 LRP4 (extracellular) scFv [N207/27] N207/27 scFv LRP4 (extracellular) Mouse Mouse 190538...

  15. Distribution to Industry

    Type
    Collection
    ...account, you can place orders through our website. Please note that all orders must be placed online through...Information Featured Collections COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the ... account has been verified, you will be able to place your order on our website. Placing an Order: After...Center . The MTA Process: Once your order has been placed on our website, Addgene will email you a link to...

  16. Antibody Guide

    Type
    Collection
    ...suspended in the original media or isolated and placed in a buffer. Antibody Structure Figure 1: Structure...of 4 IgA1; IgA2 IgD Coexpressed with IgM on the surface of most immature B cells; function is unknown Monomer...by a capture antibody (sandwich). Block unused surface-binding sites in the wells with a blocking protein...sandwich ELISA, a capture antibody, bound to a surface, is used to capture the protein of interest and...In IHC, tissue sections are assayed and the extracellular matrix remains intact. The signaling molecule...enzyme. In ICC, cells have most or all of their extracellular matrix removed. Again, the signaling molecule...cells. Cells, with labeled antibodies bound to surface receptors, are “flowed” through a flow cytometer...

  17. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “+” heterodimeric FokI...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “-” heterodimeric FokI...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. ( Doyon ...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. ( Doyon ...

  18. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...187,535 Advanced Catalogue of Epigenetic Regulators (ACER) 226117 Knockout Human Lu 3rd 10 8,205 Bassik Human...–6 67,366 (Set A) 67,194 (Set B) Cas13a/C2c2 Protospacer flanking site (PFS) Library 79153 Knockout E....E. coli Zhang N/A N/A N/A - The protospacers contained in the library represent all 4096 (4 6 ) combinations...Knockout Human J. Chen 3rd 10 4,530 Murine Cell Surface Protein Knockout (McspKO) Library 200445 Knockout...Sabatini and Lander 3rd 10 Varies FNLCR CRISPRa Cell Surface Libraries 207471 1000000228 Activation Human Chari...

  19. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Find prime editor plasmids for (search and replace) genome editing....CRISPR Blog Posts Prime editing is a “search and replace” gene editing method in which a reverse transcriptase...with a typical gRNA, the pegRNA is designed with a spacer that binds to a specific genomic DNA locus and ... reverse transcription. The edited DNA strand displaces the unedited 5’ flap and the resulting heteroduplex...

  20. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC119819, RLF, RLNL INSL4 insulin-like 4 (placenta) EPIL, PLACENTIN INSL5 insulin-like 5 MGC126695, MGC126697...recognition by T cells of foreign antigens on the surface of antigen presenting cells (APC) including dendritic...MHC class I and class II molecules found on the surface of APC. BCR Signaling B cells mediate humoral immunity...MHC class I and class II molecules found on the surface of APC. Symbol Name Synonyms ADRM1 adhesion regulating...BETA1AR, RHR ADRB2 adrenergic, beta-2-, receptor, surface ADRB2R, ADRBR, B2AR, BAR, BETA2AR AGRP agouti related...bromodomain containing 8 SMAP, SMAP2, p120 BTC betacellulin - C19orf10 chromosome 19 open reading frame ...
Showing: 61 - 80 of 721 results