We narrowed to 729 results for: STO
- 
  TypeCollection...brain tissue. PRISM begins with the delivery of stochastic combinations of cell-filling antigenically distinct...individual synapses. Figure 2: PRISM workflow. A) Stochastic infection of pooled AAVs delivered in vivo generates...
- 
  Chemogenetics AAV PrepsTypeCollection...Gi) hM4D(Gi) - Inhibition HA fusion none 2, 5 Christopher Richie 121539 pAAV SYN1 HA-hM3D(Gq) hM3D(Gq) ...) - Activation HA fusion none 2, 5, rg* Christopher Richie 50467 pAAV-CaMKIIa-HA-hM4D(Gi)-IRES-mCitrine...
- 
  Worm Expression ResourcesTypeCollection... described in Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis... - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold Spring ...
- 
  Allen Institute for Cell Science Plasmid CollectionTypeCollection...109121 HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP ...
- 
  AAV Packaged on RequestTypeCollection... biosafety protection levels. We offer 1,050 in-stock viral vector preps, delivering high quality and ...scientists sometimes require preps beyond our current in-stock capabilities. To meet that need, our Packaged on...
- 
  Adeno-associated virus (AAV) PlasmidsTypeCollection...originally discovered as contaminants of adenovirus stocks. One major advantage of using AAV for research ... and learn about our options for hundreds of in-stock preps that are ready to ship right away, as well...
- 
  CRISPR Plasmids - Mammalian ExpressionTypeCollection... Available modifications include histone acetylation by p300, histone demethylation by LSD1, cytosine ...
- 
  Ras PathwayTypeCollection...oncogene homolog Muscle RAS oncogene homolog Neuroblastoma RAS viral (v-ras) oncogene homolog RASA RASA1...RASSF10 Ras association domain family member RB1 Retinoblastoma 1 RCE1 Ras converting CAAX endopeptidase 1 ...
- 
  CRISPR GuideTypeCollection...insertions, or frameshift mutations leading to premature stop codons within the open reading frame (ORF) of the... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers... green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence microscopy...gene by shifting the ORF and/or creating premature stop codons NHEJ N on- H omologous E nd J oining; A DNA...
- 
  Validated gRNA SequencesTypeCollection...Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586 cut S. pyogenes 26018130 Xue Lox-STOP-Lox synthetic...
- 
  CRISPR Plasmids - Empty gRNA VectorsTypeCollection...Empty gRNA expression vectors for insertion of custom gRNA target sequences...._LacZ 74293 Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes,...
- 
  Fluorescent Protein Guide: BiosensorsTypeCollection...Constitutive or Cre-dependent) Cell-specific restoration of stimulus preference after monocular deprivation...cerevisiae cpFRET Kit includes plasmids to construct custom biosensors ScEnSor Kit includes fluorescent reporters...
- 
  CRISPR Plasmids - EpigeneticsTypeCollection...for targeted epigenetic modification, including histone acetylation/demethylation, and cytosine methylation...
- 
  CRISPR Plasmids for Genomic VisualizationTypeCollection...like GFP, researchers have turned dCas9 into a customizable DNA labeler compatible with fluorescence microscopy...
- 
  DNA Service - Cloning Grade DNATypeCollection...resources you may find helpful. Our Scientific and Customer Support Teams are also available to provide assistance...
- 
  Bikard Lab - CRISPR Repression CollectionTypeCollection...possible to study the effect of the amount and stoichiometry of enzymes. The pLC97 plasmid allows for quick...
- 
  CRISPR Plasmids and ResourcesTypeCollection...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial...
- 
  CRISPR Plasmids - C. elegansTypeCollection...Ingestion by C. elegans none, need Cas9 plasmid Ristow Do you have suggestions for other plasmids that...
- 
  Synthetic Biology - OverviewTypeCollection...Lei Stanley Qi Jeff Tabor Jan-Willem Veening Christopher Voigt Clifford Wang Ron Weiss Synthetic biology...
- 
  Recombinases AAV PrepsTypeCollection...Recombinases VCre AAV Browse the following tables for in-stock AAV preps that encode site-specific recombinases...