We narrowed to 972 results for: arc

...Vectors Wild-type AAVs have been modified by researchers to create recombinant adeno-associated viral ...in combination with foreign capsid proteins. Researchers have further refined the tropism of rAAV vectors...diffused biological structures. Specifically, researchers were interested in creating systemic capsids ...send information to a given region. This allows researchers to trace connections between neurons, map the...make them ideal for gene therapy, neuroscience research, and other biomedical fields. Gene Therapy One... opsins and other optical tools developed by researchers are used to detect, measure, and control molecular...institution's best practices with regard to AAV-related research. See Addgene’s Biosafety Resource Guide for more...

...types include murine leukemia virus (MLV), murine sarcoma virus (MSV), and feline leukemia virus (FeLV). ...treatments into cells, and has been widely used in the research community for decades. Wildtype gamma-retroviruses...vectors have many aspects that make them useful research tools in a variety of cell types and models, such...integration, gamma-retroviral vectors are useful research and clinical tools thanks to their long-term expression...practices with regard to gamma-retroviral-related research. See Addgene’s Biosafety Resource Guide for more...Retroviral Vectors and Their Uses in Scientific Research Gamma-retroviral Packaging Systems The Retroviral... enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https://doi.org/10.1093/nar...

...enables researchers to manipulate the genome with relative ease. Over the past decade, researchers have ...are many different Cas proteins available, and researchers can adapt these experiments for different organisms...framework to get you started using CRISPR in your research and setting up CRISPR experiments. We will focus...proceeding, we recommend asking labmates/colleagues, searching the literature, or discussing with your PI to ...

...codon-amino acid pairs. Over the past two decades, researchers have also expanded the genetic code by redirecting...chromosomal DNA. Although they can be found in archaea and eukaryotes, they play the most significant ...phoA supE44 thi-1 gyrA96 relA1 tonA EPI300 LGC Biosearch Technologies; MilliporeSigma F- mcrA Δ(mrr-hsdRMS-mcrBC...fragmented into small pieces, labeled with a short DNA barcode, and amplified. These DNA fragments are attached...information to aid in the reproducibility of scientific research. Long-read Sequencing Sanger sequencing and Illumina...

...MoClo Plasmid Kits Available from Addgene Browse or search the table below to find MoClo kits in our collection...Johannes Stuttmann 95 additional plasmids for hierarchical assembly of plant multigene constructs. MoClo...characterized parts that can be used for bottom-up hierarchical assembly of single and multi-gene constructs...species. Ubigate Collection Bacterial Expression Marco Trujillo Plasmids for reconstituting the ubiquitination...

...constant regions of other antibodies. This has useful research applications, and is covered in the following ...conjugating reactions are possible. It is important to research your reaction and buffer before conjugating your...powerful, but in order to utilize it in the lab, researchers must be able to detect if and where an antibody...antibodies validated for a similar assay type) and search again. After filtering, narrow down further by ...

...DNA, is an essential process used in scientific research and discovery. With molecular cloning, scientists... on choosing the right cloning method for your research project . This guide highlights several of the...are naturally produced by certain bacteria and archaea, cleave double-stranded DNA (dsDNA) at specific...

...range of topics in molecular biology, laboratory research, and career development. eBooks Download any of... enzymes to assist with your molecular biology research. Topics include: Antibiotic Concentrations for...

...tools and technologies developed for optogenetics research utilize light to detect, measure, and control ...different types of viruses that are commonly used in research, including: Lentivirus Adeno-associated Virus ...

...with BioRender.com. Common Bacterial Promoters Researchers often incorporate the following promoters into...regulatory elements. Common Eukaryotic Promoters Researchers often incorporate the following promoters into...

... Forward pREP Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA...Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma virus (RSV) env gene Forward Rluc-F CCAGGATTCTTTTCCAATGC...

...Sternson SM (2019). Ultrapotent chemogenetics for research and potential clinical applications. Science, ...