We narrowed to 1,042 results for: ins;
-
TypeBlog Post...since these processes are mediated by other viral proteins), but the newly released RABV cannot infect any...
-
Synthetic promoter AAVs for cell-type specific expression in retinal cells
TypeBlog Post...certain cell types. Botond Roska’s lab at the Institute of Molecular and Clinical Ophthalmology Basel ... -
Tips for Titering Your Lentiviral Preps
TypeBlog Post...The day has arrived; you’ve painstakingly cared for your packaging cell line, prepped your DNA, transfected... -
CRISPR Plasmids and Resources
TypeCollection...generates large genomic deletions. Insert NEW CRISPR transposases insert large fragments of DNA. Transcriptional...nickase enzymes fused to reverse transcriptase install new genetic information into a specific DNA site... -
Academic vs. Industry Postdocs
TypeBlog Post... decide what they’d like to work on later. For instance, AstraZeneca posts most of its positions all at... -
p53 Pathway
TypeCollection...candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin...DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor binding protein 3 KAI CD82 molecule... -
Validated gRNA Sequences
TypeCollection...GTGGTGGGCCGCAGTCACAA 66894 cut S. pyogenes 26178787 Winslow Lox-STOP-Lox synthetic GCGTATAGCATACATTATACG 66586...GCGAGGTATTCGGCTCCGCG 66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT...TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787 Winslow NeuN M. musculus TCCGGTTCAGGGACCCCGAC 60227 cut... cut S. pyogenes 26480473 Wolfe ttTi5605 Mos1 insertion site C. elegans ATATCAGTCTGTTTCGTAA 47550 cut ... -
Brain Initiative Collection
TypeCollection...that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed expression...expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed expression...-AAV9 pAAV-hsyn-GRAB_DA-mut Expresses the DA-insensitive control sensor GRAB_DA-mut in neurons Yulong ...pAAV-hsyn-GRAB_rDA-mut Expresses the red fluorescent DA-insensitive control sensor GRAB_rDA-mut in neurons Yulong... -
Controlling for Off-target Effects with a New Genome-wide CRISPR Screen Design
TypeBlog Post...genome-wide CRISPR screen presented in Morgens et al. contains three types of guides: 1) targeting guides (blue... -
Tips for Writing a Good Cover Letter
TypeBlog Post...Highlight your achievements with specific examples. Instead of saying “I have excellent communication skills... -
5 Reasons to Use Reddit for Science Communication
TypeBlog Post...excellent posts on science career topics as well. Instead of rewriting or coming up with answers, I was able... -
Filming Science Videos in the Age of Social Distancing
TypeBlog Post...two options: Film outside at a distance, or film inside with one person in a room. I wouldn’t be in there... -
Is this the right place for me? 8 tactics for choosing a lab
TypeBlog Post...and sarcasm, persistent teasing, name calling, insults, intimidation, sexual harassment Isolation – including... -
Deep Dive: Statistical Tests (Comparisons)
TypeBlog Post...analysis plan when you design your experiment, instead of after you’ve already run it.) You don’t need... -
Tags and Other Markers
TypeCollection...antibodies targeting epitope tags and common fusion proteins.... target epitope tags and other common cellular proteins. These ready-to-use recombinant monoclonal antibodies... -
Synthetic Biology - Sensing and Signaling
TypeCollection...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter Tags PI Publication Do you... -
TREAT-AD Plasmid Collection
TypeCollection...table based on plasmid name, gene/insert, and more. ID Plasmid Gene/Insert Vector Type Backbone Mutations... -
Synthetic Biology - Metabolism
TypeCollection...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection...Networks & Gene Regulation Sensing & Signaling Strains Browse Addgene's collection of synthetic biology...available from this depositor's lab. Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top... -
Zinc Finger Consortium Reagents
TypeCollection...reagents for engineering and expressing zinc finger proteins deposited by Zinc Finger Consortium members like...reagents for engineering and expressing zinc finger proteins for distribution to academic and nonprofit laboratories...