We narrowed to 232 results for: SPL;
-
TypeBlog Post...experts ask you about the details and then you can display your deep knowledge of your experiments and field...
-
Adeno-associated Viruses (AAVs) for Genome Editing
TypeBlog Post..., the preferred vector, contains a promoterless splice acceptor-IRES-neoR gene, which enhances the efficiency... -
March for Science
TypeBlog Post... that thoughts on some non-political issues are split along party lines (18). Feeling like an apple will... -
Deep Mutational Scanning with One Pot Saturation Mutagenesis
TypeBlog Post...mutational scanning: ligand binding assays, phage display assays, ubiquitination activity assays, toxin activity... -
Site Directed Mutagenesis by PCR
TypeBlog Post...digest products of the unmodified plasmid will be split into two smaller bands (Figure B, digest A). In ... -
Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons
TypeBlog Post...state. In contrast, Brainbow-3.1 and -3.2 do not display default fluorescence due to the addition of translation-blocking... -
Easi-CRISPR: Generating Knock-In and Conditional Mouse Models
TypeBlog Post...previously made mouse model. To avoid disrupting splice donor/acceptor sites, Miura et al. (2018) recommend... -
Is this the right place for me? 8 tactics for choosing a lab
TypeBlog Post...choose are teaching the stuff you want to know and display character traits and skills that you hope to grow... -
Antibodies 101: Validation
TypeBlog Post...alternative translation start sites or alternative splicing that could lead to some form of the target protein... -
Plasmids 101: Using Transposons in the Lab
TypeBlog Post... Types of transposons Transposable elements are split into two classes based on their mechanism of transposition... -
Transferable Skills Guide: Teamwork
TypeBlog Post...slowly gone crazy. As it was, my partner Mike and I split the work, shared the credit, and we both won accolades... -
Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2: Reprogramming and Transdifferentiation
TypeBlog Post...D.A., et al., Generation, purification and transplantation of photoreceptors derived from human induced... -
Antibody Validation for Flow Cytometry
TypeBlog Post...when transiently overexpressed in CHO cells and displayed similar labeling patterns on different primary... -
Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs
TypeBlog Post...critical role the work would not have been possible. Display of work in artistic exhibitions or showcases (not... -
Delivery Methods for Generating iPSCs
TypeBlog Post... to tumor formation in iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses... -
Protocol - Over-Agar Antibiotic Plating
TypeProtocol...Over-Agar Plating of Carbenicillin. The above graph displays the stock concentration of Carbenicillin stock... -
Weighing Reagents Protocol
TypeProtocol...provide more accuracy as these types of scales display more decimal places. Pro-Tip If you’re weighing... -
Water Bath Protocol
TypeProtocol...bath, but will likely involve a dial or a digital display you can set to the correct temperature. Set up ... -
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More
TypeBlog Post...cassette. The simpler system of pCRISPomyces-2 displays a higher editing efficiency, perhaps due to its... -
General Transfection
TypeProtocol...obtaining high levels of virus. HEK293T cells should be split 3 times a week: Monday: Plate 1x10 6 cells in a ... -
Gibson Assembly Protocol
TypeProtocol...correctly assembled plasmids by designing primers to split an antibiotic resistance gene to effectively create... -
Lentivirus Production
TypeProtocol...obtaining high viral titer. 293T cells should be split 3 times a week: Monday: Plate 1×10 6 cells in a ... -
Antibody Validation Using the Indirect ELISA Method
TypeProtocol...greenish solution. Stop the reaction before any wells display a green product. A precipitated product indicates... -
CRISPR Library Amplification
TypeProtocol... is better than pulling motion Take care not to split or gouge agar during the scraping process. Add each... -
27 Hot Plasmids from 2016
TypeBlog Post.... Each gene was chosen to represent the primary splice variant in 38 types of human cancer. Many of the... -
Adeno-associated virus (AAV) Guide
TypeGuide...AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different AAV serotypes. Pseudotypes Pseudotyping...derived from eight different serotypes. AAV-DJ displays a higher transduction efficiency in vitro than...specific cell and tissue types, like AAV-DJ8, which displays enhanced brain uptake. Systemic capsids Another...employed to engineer an rAAV serotype variant able to display neuronal retrograde transport, AAVrg. Retrograde...limitation for CRISPR delivery for more information. Split AAVs to increase packaging capacity Another strategy...derived plasmids and base/prime editors, is to create split AAVs. Here, a longer transgene is broken down between...different mechanisms. One of these methods uses splice site donor and acceptor sequences to reconstitute... -
Sequencing Primers
TypeGuide...promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG...vector, forward primer SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR, forward primer SP6 ... -
Lentiviral Vector Guide
TypeGuide... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export... a few key ways. First, the packaging system is split into two plasmids. Although safer, this system can... -
CRISPR Guide
TypeGuide... reverse transcription. The edited DNA strand displaces the unedited 5’ flap, and the resulting heteroduplex...including editors based on a second ADAR variant that displays improved specificity, and editors carrying an ... in vivo RNA imaging or to control alternative splicing. Figure 13: Overview of RNA targeting (A) and ...locus-specific targeting of long RNAs with CRISPR-Display. Nature Methods , 12 (7), 664–670. PMID: 26030444... -
Plan Your Experiment
TypeGuide...should be made HDR requires a repair template and displays reduced efficiency compared to NHEJ knockout. ...region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since ... -
Optogenetics Guide
TypeGuide...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function... -
Adenovirus Guide
TypeGuide...26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted terminal repeats...