Skip to main content

We narrowed to 255 results for: tre promoter

Showing: 201 - 250 of 255 results
  1. CRISPR Between the Genes: How to Experiment with Enhancers and Epigenomics

    Type
    Blog Post
    ...regulatory regions in the genome, including enhancers, promoters, insulators, and more. I then identified valid...and stop. For instance (chr3, 1, 10) indicates a stretch of DNA at the very beginning of the third chromosome... Let’s now examine how we can locate powerful stretches of DNA known as enhancers with the help of genome...light on dark matter Precise knowledge of which stretches of the genome are pillars for stem cells, or metastasized...
  2. Academic vs. Industry Postdocs

    Type
    Blog Post
    ...a requirement. Your manager: Unlike academia, promotions in industry are based on people’s ability to ...afford to spend too much time working on something extremely risky or exploratory. Getting a job afterwards...
  3. xCas9: Engineering a CRISPR Variant with PAM Flexibility

    Type
    Blog Post
    ...continuous outflow of phage, increasing stringency and promoting survival of only the broadest-targeting variants..., also has a strict editing window about 15 nt upstream of the PAM. Even if there’s a PAM near your insertion...
  4. Tips for arabidopsis transformation

    Type
    Blog Post
    ...are binary gateway vectors and can be used for promoter swapping and generating N and C terminally tagged...healthy plants: Your plants should show no signs of stress, such as anthocyanin production, or disease, such...When your T1 is on soil and has recovered from the stress of selection you can clip a leaf and extract genomic...
  5. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...toxicity. AAV vectors can be equipped with strong promoters for high and neuron-specific transgene expression...AAV2-retro vectors with a variety of transgene/promoter combinations. Check out our retrograde AAV blog...forming a neuronal loop which is activated and strengthened during memory formation and memory retrieval..., causes neurotoxicity, and is lethal if left untreated (for review see Dietzschold et al., 2008). Herpes...PubMed Central PMCID: PMC3275419. Maday, S., Twelvetrees, A.E., Moughamian, A.J., and Holzbaur, E.L.F....Roberts, T. F., Hisey, E., Tanaka, M., Kearney, M., Chattree, G., Yang, C. F., Shah, N.M., and Mooney, R. (...
  6. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Doyon 214916 TRE-TDP-43deltaNLS-mClover3 TARDBP mClover3 TRE ALS Ophir Shalem 214917 TRE-mClover3-TDP-...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...pEHA1628) SNCA Avi TRE Parkinson's Vikram Khurana 210360 TMEM106B-2Strep TMEM106B Strep CMV, T7 Frontotemporal...Flag CMV ALS Yossi Shiloh 34927 pTRE_tau-LacZ::tTA-H100Y MAPT LacZ TRE Parkinson's, FTD Mark Mayford 35000...telangiectasia Stephen Elledge 43918 tetO-ALN NR4A2 His, V5 TRE Parkinson's John Gearhart 44333 pMX_mTBP TBP LTR ...Richard Youle 50487 pSLIK-NFLAG-hFUS FUS Flag, His TRE ALS Zissimos Mourelatos 51146 DsRed-p150 217-548 ...Dent 188572 Tet-off TauRD (P301L/V337M) MAPT Myc TRE Parkinson's, FTD Franz-Ulrich Hartl 188573 Tet-off...
  7. Transferable Skills Guide: Managing a Team

    Type
    Blog Post
    ...skills guide: managing a team. You’ve just been promoted, congratulations! You’re now a manager with your...motivates you!), know their unique skills and strengths (you will likely have reports with different levels...
  8. Course-Based Undergraduate Research Experiences (CUREs)

    Type
    Blog Post
    ...while also broadening access to experiences that promote professional success (many of my students include...1977; Ma et al., 2020). Many have interpreted this trend as evidence that the best teachers and mentors pass...
  9. Lab to Office Culture Shock

    Type
    Blog Post
    ...be these skills that get you your next job or promotion. Also, don’t wait until you’re out of the lab ...question today, because I sometimes wish for a stretch of time that doesn’t involve critical thinking....
  10. Zebrafish Plasmid Collection

    Type
    Collection
    ...plasmids with four promoters, six fluorophores, and empty vectors designed to streamline the production of...Zebrafish Society (IZFS) - An organization that promotes and advocates for zebrafish research in the international...
  11. Getting the Most from Your Lentiviral Transduction

    Type
    Blog Post
    ...enough to prevent confluency but high enough to promote cell growth. Overgrown cultures stimulate quiescence... yeast, fungi, or bacteria, mycoplasma can be extremely hard to detect with levels reaching 108 cells ...Daily medium exchanges help alleviate cellular stresses associated with pH changes and resource consumption...particles you harvest. Studies have demonstrated that extreme changes in osmotic pressure and pH can destabilize...labs try to use freshly collected lentivirus for downstream applications. While this ensures that the highest...23179822. 5. Segura, M.M., Kamen, A., Garnier, A. “Downstream processing of oncoretroviral and lentiviral gene...
  12. Harnessing TnpB for Genome Editing: A Compact and Versatile Tool for Your Research

    Type
    Blog Post
    ... difference between them lies in the choice of promoter for ωRNA (reRNA) expression (see Figure 1). Both... PAM sites. For Cas9, the PAM is located just downstream (3′ end) of the target sequence, while for Cas12a...Cas12a and TnpB, the motif is found upstream (5′ end) of the target site. Additionally, the TAM changes... region binds to the DNA sequence immediately downstream of the TAM. This RNA-DNA hybrid formation recruits...cleaves the DNA at a position 15–21 base pairs downstream of the TAM, creating staggered double-strand ...target gene. Choose a 20-nt sequence immediately downstream of the TAM for targeting. While plant-specific...
  13. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...beneficial for many systems. How the EDGE Program promotes scientific sharing The EDGE Program is designed...to study life’s innovations from anywhere in the tree of life.” Accepted proposals were required to present... arose in different branches of the evolutionary tree at least 6-7 times and on at least 2 separate continents...especially cardenolides which have been used to treat heart disease. Caterpillars that eat milkweed generate...Joshua Rosenthal) The Hawaiian bobtail squid has an extreme number of nerve cells and an unusually high level...
  14. Deep Mutational Scanning with One Pot Saturation Mutagenesis

    Type
    Blog Post
    ...interest. A low primer-to-template ratio is used to promote annealing of one primer to each template. The PCR...restriction site, but nick opposite strands of DNA. Treating the plasmid with ExoIII and ExoI then fully degrades...by Wrenbeck et al but it’s likely that longer stretches of sequence could be used. However, a practical...assessing protein function on a massive scale." Trends in Biotechnology 29.9 (2011): 435-42. PubMed PMID...
  15. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ...CRISPR Guide . Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Return to top...spacer sequence and contain a PAM sequence just downstream of the sequence to be cleaved. This non-specific...
  16. An Introduction to Adenovirus

    Type
    Blog Post
    ...from a replicating adenovirus using native viral promoters. Mol Ther, 7(4), 526–534. https:/doi.org/10.1016...as other intracellularly-exposed proteins and downstream cellular events, all recruit strong innate and...
  17. Changing Labor Laws Bring Increased Postdoc Wages

    Type
    Blog Post
    ...help them navigate the scientific enterprise and promote their voices in driving changes in science. Follow...that salaries may even double. The University of Notre Dame sets no minimum, stating that while they recommend...
  18. CRISPR Guide

    Type
    Collection
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA — addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...
  19. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ... in mapping of regulatory elements (to mutate promoters/enhancers in reporter constructs), in functional...introduced anywhere in the plasmid (albeit at extremely low frequency), and these could interfere with...
  20. Transferable Skills Guide: Conflict Resolution

    Type
    Blog Post
    ...When you go on interviews or are looking for a promotion, have some solid examples of times when you have...natural inclination for this skill that you could strengthen. The right set of transferable skills, coupled...other just for the sake of disagreeing. It can be extremely toxic in a lab or work environment if left unchecked...conflict resolution is likely not one of your strengths. Empathizing with people, especially people with...conflicts within a given organization, it can help tremendously to have as much context as possible. When I ...recognize that conflict resolution may never be a strength for you. But if you are a problem solver, and ...
  21. CRISPR-mediated Plant Base Editors

    Type
    Blog Post
    ...RNA (protospacer+scaffold) in a pol-III (OsU3) promoter driven expression system. We use a single polycistronic...conversion of a target ‘A’ to ‘I’ (inosine), which is treated as ‘G’ by cellular polymerases. Subsequently, an...developed using the hAPOBEC3 deaminase can edit in a stretched window ranging from 1-17 bp relative to the PAM...
  22. Cutting Once Is Harder Than It Sounds: Your Guide to Minimizing Off-Target Effects

    Type
    Blog Post
    ...sgRNA design note When expressing gRNAs from a U6 promoter, remember that transcription typically requires...between on-target and off-target cutting varies tremendously between targets. On-target prediction tools ...cleaved (cleavability rank). By combining these two trends, the cleavage rule can be established: If a nuclease...
  23. Using Phosphoserine to Study Protein Phosphorylation

    Type
    Blog Post
    ...that binds specifically to phosphate moieties and promotes a robust mobility shift in phosphorylated, but...pSer-incorporation on enzyme function through phosphatase treatment. If a candidate phosphatase is unknown, CIP or...
  24. Exploring Applications of the Bioluminescent HiBiT Tag

    Type
    Blog Post
    ...HiBiT is compatible with both strong and weak promoters, and even modest endogenous pools generate high...protein. Together, the work links p53 mutations to treatment outcomes and provides a HiBiT-enabled framework...track the internalization of EGFR in real time treatment with EGF. Due to the lack of membrane permeability... HiBiT still present on the cell surface. EGF treatment resulted in rapid internalization and diminished...
  25. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ...sites on the target DNA, and thus inactivating the promoter. Image reused with permission from Neumann et ...this proof-of-concept study) are captured on streptavidin-coated magnetic beads through an assembly of...with a GFP nanobody (Figure 1). This enrichment streamlines the purification and minimizes sample loss while...
  26. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ...integration at regions of open chromatin, especially at promoter or exonic regions. If the cell’s chromatin structure...piggyBac-ing models and new therapeutic strategies.,” Trends Biotechnol., vol. 33, no. 9, pp. 525–33, Sep. 2015...
  27. How to Design Your gRNA for CRISPR Genome Editing

    Type
    Blog Post
    ...nuclease-dead Cas9 (dCas9) is directed near the promoter of a target gene. Here, the target window is not...window upstream of the transcription start site (TSS), while for CRISPRi, a ~100nt window downstream of the...ability of the cell to use an alternative ATG downstream of the annotated start codon. Likewise, we avoid...
  28. Important Considerations When Using AAVs

    Type
    Blog Post
    ...recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis...of AAVs in humans AAVs are already being used to treat disease in humans and additional improvements are...transduction efficiency, and safety profiles should strengthen its appeal for the scientific and medical communities...
  29. Plasmids 101: Using Transposons in the Lab

    Type
    Blog Post
    ...example, piggyBac and Tol2 are best for screening promoters and enhancers since they are biased to insert ...from the donor molecule, and inserts it ~50 bp downstream of QCascade’s genomic target site (Fig. 3B). ...from the donor molecule, and inserts it ~50 bp downstream of QCascade’s genomic target site.  T-RL= transposon...
  30. p53 Pathway

    Type
    Collection
    ... the best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in...suppressor activated by cellular stresses like DNA damage, oxidative stress, and nutrient deprivation. p53...factor and tumor suppressor activated by cellular stress. Cancer...
  31. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ...activates hypoxia inducing factor (HIF-1), which promotes the production of VEGF to increase angiogenesis...labor with up and coming immunotherapy treatments. As treatments enter the clinic, physicians and researchers...more vasculature to feed themselves, use the blood stream to commute to and invade multiple organs, and most...cause, manifestation, diagnosis, recurrence, and treatment of cancer have been extensively explored. Biologists...compromised either due to age, infections, or other strenuous biological changes. In contrast to the acute immune... cytokines like TGFβ and IL-6. However, when strengthened through efforts to boost the activity of the... ability of even these conventional antitumor treatment strategies can be enhanced. Types of immunotherapeutics...
  32. Viral Vectors 101: AAV Serotypes and Tissue Tropism

    Type
    Blog Post
    ...expression from rAAVs also depends on your choice of promoter/enhancer. Table 1: AAV capsids and receptors. ...developed from prior natural exposure or rAAV treatment, which can pose problems for gene therapy applications...
  33. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ...spectrum. When photons are absorbed by matter, they promote electrons within atoms to a higher energy state...fluorescence. Another way to label proteins is through treating cells with fluorophore-conjugated antibodies that... fluorophore's brightness refers to the signal strength of the emitted photons detected by the cytometer...
  34. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

    Type
    Blog Post
    ...iPSC-derived osteoblasts and osteoclasts together promote bone regeneration in 3D biomaterials. Sci Rep, ...examples of transdifferentiation in vitro where treatment of mouse fibroblasts with 5-azacytidine led to...Mukherjee. Kusumika (Kushi) Mukherjee is the Editor of Trends in Pharmacological Sciences, a Cell Press reviews...adult pancreatic alpha-cells to beta-cells after extreme beta-cell loss. Nature, 2010. 464(7292): p. 1149...expression of insulin genes in liver and ameliorates streptozotocin-induced hyperglycemia. Nat Med, 2000. 6(5):... PMID: 18754011. 43. Zhou, Q. and D.A. Melton, Extreme makeover: converting one cell into another. Cell...
  35. Typing CRISPR Systems

    Type
    Blog Post
    ...because it can process multiple gRNAs under a single promoter, allowing for easy multiplexing. The double-stranded...bacterial and archaeal immune systems has led to extreme sequence divergence that requires a multi-pronged...subtypes, A–C, with the beloved SpCas9 (from Streptococcus pyogenes) belonging in II-A. Cas9 was the first... CRISPR-Cas: beyond the Cas10 effector complex. Trends in Biochemical Sciences, 49(1), 28–37. https://...
  36. Deaminet 2026: Breakthroughs in Base Editing, Deaminase Biology, and Therapeutic Translation

    Type
    Blog Post
    ...numerous high-frequency off-target sites in the HBG promoter that were missed by standard workflows, highlighting...requested base editing tools of 2025. Together, these trends reflect both the durability of foundational tools...marker and a potential stratification marker in treatment decisions. Shelby Devenport (Washington University... Behind The World's First Personalized CRISPR Treatment Resources on addgene.org CRISPR Plasmids: Addgene's...
  37. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...sequence (PFS). In bacteria, Cas13 targeting also promotes non-specific RNA cleavage, but this non-specific...mouse, and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots...20 bp in length and paste them into contiguous stretches of DNA known as CRISPR arrays. Separate Cas proteins...proteins or RNAs through ChIP (enChIP) or biotin-streptavidin pulldown (CAPTURE.) Tag : Multiple methods make...exploring therapeutic applications of CRISPR to treat genetic disease, with the caveat that off-target...
  38. Plasmids for Stem Cell Research

    Type
    Collection
    ...lentiviral plasmids The acetyllysine reader BRD3R promotes human nuclear reprogramming and regulates mitosis...Nature. 2011 Jul 13. doi: 10.1038/nature10323. Crabtree Fibroblasts Motor Neurons Retroviral Mouse/Human...
  39. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...into the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal... and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal/leader...DEPDC5 Human Mouse IgG2a 206594 Anti-TRESK K+ channel [N467/1R] TRESK K+ channel Mouse Mouse IgG2a 206595...Mouse IgG2a 225384 TREK-1 K+ channel (Mus musculus) recombinant monoclonal antibody. TREK-1 K+ channel Mouse...translocation of the light chain across the ER membrane. Downstream of the insert is a heavy chain constant domain...
  40. Promoters

    Type
    Guide
    ...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...elongation factor promoter TRE Inducible Multiple Tetracycline response element promoter; often optimized...core promoter is the TSS, which is where transcription begins. Proximal Promoter Further upstream from... upstream of the proximal promoter. The distal promoter also contains transcription factor binding sites...
  41. Immunology Research Plasmids and Resources

    Type
    Collection
    ... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...antigens through the B cell receptor (BCR). The strength and duration of signaling controls the fate of...Growth Factor beta (TGFbeta) signaling and its downstream effector molecules, the Smad proteins, regulate...KIAA0403, LMOR, MOR, MOR1, OPRM OSGIN1 oxidative stress induced growth inhibitor 1 BDGI, OKL38 OSM oncostatin...SRP, UCN-II, UCNI, UR, URP UCN3 urocortin 3 (stresscopin) MGC119002, SCP, SPC, UCNIII UTS2 urotensin 2...
  42. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4...
  43. Molecular Biology Reference

    Type
    Guide
    ...located downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or.... The strength of the promoter can control the level of insert expression, as a strong promoter directs...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...genetic element. For instance, a promoter of interest could be inserted upstream of the luciferase gene to determine...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...
  44. Modular Cloning Guide

    Type
    Guide
    ...plasmids including constitutive promoters, T7 expression, RBS strength variants, synthetic terminators...cross-compatible plasmids including 11 inducible promoters, 16 RBS strength variants, 8 tag-compatible RBSs, 2 secretion...insert fragments of DNA containing basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked... a single transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding ... nucleases, base editors, gRNA backbones, and promoters for genome editing in monocots and dicots. pDGE...PI Description MoClo Toolkit Plant Expression Sylvestre Marillonnet 95 plasmids for cloning and assembling...interest. Yeast Secrete and Detect Yeast Expression Sylvestre Marillonnet Plasmids to generate transcription...
  45. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https...plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...stable delivery of various genes, mutations, or treatments into cells, and has been widely used in the research...many approved gamma-retroviral gene therapies to treat disease like cancer or immunodeficiency disorders...
  46. Lentiviral Vector Guide

    Type
    Guide
    ...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...contains a chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... mitigated through the use of tissue-specific promoters and envelope genes, and/or with site-specific ...
  47. Plan Your Experiment

    Type
    Guide
    ...template Cas9 or Cas9 fusions with proteins that promote HDR Requires a repair template Lower editing efficiency...prime editing. CRISPR Intereference : Target the promoter region of the gene of interest, where the Cas9...approaches, the species and expression pattern of the promoter for both your Cas enzyme and gRNA and the presence...the wide range of options for the Cas enzyme, promoters, and selection markers. There are also no packaging...to specific cell types by using cell-specific promoters, which is useful for in vivo studies. While we...transfect, transduce, or may not express common promoters. Browse Cas9 plasmids for RNP delivery . As mentioned...protein product. Be aware that there could be downstream translation start sites that could allow for ...
  48. Chemogenetics Guide

    Type
    Guide
    ...commercially available. Table 4: Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor...binding then activates G-proteins to modulate downstream signaling. GPCRs have been shown to be involved...signaling by inhibiting adenylate cyclase and downstream cAMP production. There are currently two Gi DREADDs...Silvagnoli, A. D., Crespo, E. L., Schalau, R., Gott, M., Tree, M. O., Dunbar, G. L., Rossignol, J., & Hochgeschwender...N., Simkins, J., Crespo, E. L., Ikefuama, E. C., Tree, M. O., Prakash, M., Björefeldt, A., Barnett, L....
Showing: 201 - 250 of 255 results