...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...library page. Find Pooled Libraries of Interest Click on different properties to create a custom filtered...Activation Human Zhang 3rd 10 96,458 Human CRISPR Metabolic Gene Knockout Library 110066 Knockout Human Sabatini...Knockout Human Olzmann 3rd ~10 13,920 Human lncRNA Splicing-targeting CRISPR Library 119977 Knockout Human... Mouse Birsoy 3rd 7–10 2,105 630 Mouse CRISPR Metabolic Gene Knockout Library 160129 Knockout Mouse Birsoy...Knockout Mouse X.S. Liu 3rd 5 5 10 49,252 Human Metabolic Gene CRISPRa sgRNA Library 187080 Activation Human... Human Birsoy 3rd Varies 32,460 Mouse Metabolic Gene CRISPRa sgRNA Library 187081 Activation Mouse Birsoy...

... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ... enriched expression of GCaMP6s in axons with cytosolic expression of mKate2 Lin Tian 112005-AAV5 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112005-AAV9 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112006-AAV9 pAAV-hSynapsin1.... Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs. Plasmid...Plasmid Description Gene/Insert Vector Type PI Publication...

...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid ...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...non-targeted strand, Cas3 starts unraveling DNA using its helicase properties, cleaving the targeted strand non-specifically...Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions for other...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...

...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant ID...Marker PI Publication Drosophila ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty Prime...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases they cause....our Search page to look for specific genes or applications that are not listed here. Addgene Microbiology...Enterococcus sp. Geobacillus sp. Haemophilus influenzae Helicobacter pylori Listeria monocytogenes Mycobacterium ...Densmore Lab EcoFlex MoClo : Modular cloning for applications like recombinant protein purification and cell-free...fluorescent protein plasmid collection is organized by application and by color. External Resources European Saccharomyces...

...green Click-beetle luciferases (CBRluc and CBGluc, respectively). Like Firefly luciferase, Click-beetle...advantages and disadvantages depending on the application. Firefly luciferase is considerably brighter ...luciferase-based plasmid systems for many different applications. Browse the Collection Highlights section to...respectively, for increased usefulness in in vivo applications. LuxSit-i : An artificial luciferase desined...Biology CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that contains an intron in the middle...

...potential splice site mutations. The CRISPResso suite accommodates single or pooled amplicon deep sequencing... you'll need Sanger sequencing reads from PCR amplicons that cover your locus of interest and correspond... from a deep sequencing experiment a reference amplicon sequence to assess and quantify the efficiency...efficiency of the targeted mutagenesis The amplicon sequence expected after HDR can be provided as an optional...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Description Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Description Gene/Insert Antibiotic Resistance PI Publication Back to Top Do you have suggestions for other...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Plasmid Gene/Insert Vector Type Promoter Tags PI Publication Do you have suggestions for other plasmids that...