Skip to main content
Addgene
Showing: 1 - 17 of 17 results
  1. Cloning

    Type
    Guide
    ...example of a LIC protocol on our website. Ligation Independent Cloning (Figure adapted from LIC protocol ... repaired by the normal replication process. It is important to note that LIC has difficulty assembling...Independent Cloning Ligation Independent Cloning (LIC) relies on the 3'-5' exonuclease activity of T4 DNA...removes nucleotides from the end of a DNA strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates...are repaired by the bacteria after transformation. LIC does not require site-specific recombination or a...rapid cloning method. So how does this work exactly? LIC depends on the addition of only one free dNTP to ...interest and then insert them into plasmids for replication and protein expression. So how do scientists ...
  2. Molecular Biology Reference

    Type
    Guide
    ... Origin of Replication ( ori ) DNA sequence which directs initiation of plasmid replication (by bacteria...double-stranded DNA that typically carry genes and can replicate independently from chromosomal DNA. Although they...the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and each daughter cell receives...manipulating genes. For instance, most plasmids are replicated in E. coli and are relatively small (∼3000 - ...sequences for this purpose, which includes a DNA replication origin, an antibiotic-resistance gene, and a ... exists extrachromosomally in E. coli , it is replicated independently and segregated to the resulting...form, plasmids require a bacterial origin of replication ( ori ), an antibiotic-resistance gene, and at...
  3. Antibody Guide

    Type
    Guide
    ...single assay. Overview of Antibody Applications Antibody-based applications can be generally classed into ...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...production and storage techniques, and explain common applications. Science... Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods...of other antibodies. This has useful research applications, and is covered in the following Isotypes section...signaling molecules and are often used in clinical applications. Diabodies - Diabodies contain two Fab fragments... molecules that can be distinguished in your application. The indirect detection method uses an unconjugated...
  4. CRISPR Guide

    Type
    Guide
    ...Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an interesting... every genomic target. Due to its comparative simplicity and adaptability, CRISPR rapidly became the most... to various Cas enzymes have extended CRISPR applications to increasingly complex functions, including...understanding of CRISPR biology, introduce the various applications of CRISPR, and help you get started using CRISPR... Cas12a, which are available for specialized applications. Check out our list of additional Cas proteins...genomic edits carried out by Cas9. Multiplexing applications include editing multiple genes at once; using...to help you select an optimized gRNA for your application (see: Plan Your Experiment ). In addition to ...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...therapeutic applications. Clinical trials using AAV for various gene delivery applications are currently...plasmids, the first with a 3’ splice donor and the second with a 5’ splice acceptor. When these viruses...adenovirus. These genes (E4, E2a and VA) mediate AAV replication. The transfer plasmid, Rep/Cap, and the helper...optogenetic genes enables them to be packaged in AAVs. Click here for more information on optogenetics plasmids...integrations may occur at a much lower frequency. As a replication-incompetent virus, AAV cannot enter the lytic... preferred over standard viruses for in vivo applications. Scientists have also experimented with hybrid... Because the virus depends on the cell’s DNA replication machinery to synthesize the complementary strand...
  6. Adenovirus Guide

    Type
    Guide
    ...adenoviruses replication deficient? Typically yes, because the early genes necessary for replication have been... (dsDNA) molecule containing multiple, heavily spliced transcripts. At either end of the genome are i ...deletion from the viral vector renders the virus replication incompetent. E3 is involved in evading host immunity...presence of adenoviral genes E1, E4, E2a and VA for replication. For more information about AAV, read our AAV... line (either 293 or 911). To avoid creating replication competent virus, you should not serially propagate... the chance of recombination events creating replication-competent virus increases with each round of ... amplification. What is RCA? RCA stands for r eplication c ompetent a denovirus. This may occur when a...
  7. Lentiviral Guide

    Type
    Guide
    ... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export...For safety reasons, transfer plasmids are all replication incompetent and may contain an additional deletion...Interchangeable: usually encodes for VSV-G Safety Safe. Replication incompetent: Uses 3 separate plasmids encoding...encoding various HIV genes. Safer. Replication incompetent and always SIN: Uses 4 plasmids instead of 3 and...the lentiviral LTRs. While possible, it is not explicitly recommended that you use lentiviral transfer ...lentiviral are: The potential for generation of replication-competent lentivirus The potential for oncogenesis...oncogenesis The potential for generation of replication-competent lentivirus is addressed by the design of...
  8. Plan Your Experiment

    Type
    Guide
    ...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...gene you target will depend on your specific application. For example: To activate or repress a target...region is removed from the mRNA due to alternative splicing. Exons near the N-terminus are targeted since ...validate your edit will depend upon your specific application. However, there are several common ways to verify...
  9. Addgene's eBook Collection

    Type
    Guide
    ...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...introductions and helpful tips for antibody-based applications, from flow to IHC! Close About Overlay 0 of ...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...library screens, cells are infected at a very low multiplicity of infection (MOI) to increase the odds that...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...
  11. Sequencing Primers

    Type
    Guide
    ...promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG...reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of Rous sarcoma virus (RSV) env gene, forward...
  12. Chemogenetics Guide

    Type
    Guide
    ...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...chemogenetics for research and potential clinical applications. Science. 364(6436):eaav5282. PMID: 30872534...
  13. Optogenetics Guide

    Type
    Guide
    ...conformation/dimerization. In addition to the applications described above, both LOV and Dronpa can control...Arabidopsis thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~488 LOV domains...
  14. Educational Resources

    Type
    Guide
    ...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...
  15. Science Guides

    Type
    Guide
    ...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...
  16. Retrovirus Guide

    Type
    Guide
    ...read our lentivirus guide. Are γ-retroviruses replication incompetent? Yes, as with lentiviruses, the genes...
  17. Promoters

    Type
    Guide
    ...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
Showing: 1 - 17 of 17 results