We narrowed to 242 results for: p

...aid-ajmg6>3.0.co;2-o Baker SA, Chen L, Wilkins AD, Yu P, Lichtarge O, Zoghbi HY (2013) An AT-Hook Domain in...

...to Phenotype thus making progress on the NSF “G to P grand challenge.” Creating a productive, new scientific...

...Shkumatava A, Teboul L, Kent J, Joly J-S, Concordet J-P. Evaluation of off-target and on-target scoring algorithms...

...Christie, K. A., Whittaker, M. N. & Kleinstiver, B. P. Unconstrained genome targeting with near-PAMless ...

... 86–90 (2018). Farhadi, A., Ho, G. H., Sawyer, D. P., Bourdeau, R. W. & Shapiro, M. G. Ultrasound imaging...

...10.1093/hmg/10.19.2109 Sandrin V, Boson B, Salmon P, Gay W, Nègre D, Le Grand R, Trono D, Cosset F-L ...

...Central PMCID: PMC3456965. 11. Zhang B., Metharom P., Jullie H., Ellem K.A., Cleghorn G., West M.J., Wei...

...(is that pun worn out yet?) your research. Derek P. Simon received his PhD in Cellular and Molecular ...

...S13–S13 . https://doi.org/10.1038/ni.3608  Monnier P, Vigouroux R, Tassew N (2013) In Vivo Applications...

...reveal αV subunit pairing preferences with β subunits (p. 2024.01.26.577394). bioRxiv. https://doi.org/10.1101...

...doi.org/10.1038/s41596-019-0210-2 Lucia, C., Federico, P.-B., & Alejandra, G. C. (2020). An ultrasensitive,...

...PubMed Central PMCID: PMC5349099. Nguyen, Jeffrey P., et al. "Whole-brain calcium imaging with cellular...

...this publication at Addgene. Wang Z, Pan Q, Gendron P, Zhu W, Guo F, Cen S, Wainberg MA, Liang C. CRISPR...

...Repurposing retrotransposons for DNA editing By Emily P. Bentley For RNA-guided genome editing, think beyond...

...https://doi.org/10.1038/518027a  Roncador G, Engel P, Maestre L, Anderson AP, Cordell JL, Cragg MS, Šerbec...

...4354 . https://doi.org/10.1073/pnas.76.9.4350 Yang P-C, Mahmood T (2012) Western blot: Technique, theory...

...doi.org/10.1016/j.cell.2013.04.025 Zhang X, Liang P, Ding C, Zhang Z, Zhou J, Xie X, Huang R, Sun Y, Sun...

...Ousterout DG, Kabadi AM, Thakore PI, Perez-Pinera P, Brown MT, Majoros WH, Reddy TE, Gersbach CA. Correction...

...2019): 157-163. PubMed PMID: 31082625. Ernst, Oliver P., et al. "Microbial and animal rhodopsins: structures...

...Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, Reier PJ, Mandel RJ, Muzyczka N (2004...

...doi.org/10.1534/genetics.118.301532 Ebbing A, Shang P, Geijsen N, Korswagen HC (2017) Extending the CRISPR...

...-695. PubMed PMID: 23842410. 19. LeClair, Norbert P., et al. "Optimization of a ligase detection reaction-fluorescent...

...): 942-949. PubMed PMID: 15322536. 3. Dunn, Gavin P., et al. "Cancer immunoediting: from immunosurveillance...

...Many thanks to our guest blogger Derek Simon! Derek P. Simon received his PhD in Cellular and Molecular ...

...glycine tRNA-gRNA (PTG) constructs. Eukaryotic RNases P and Z recognize the tRNA sequences, cleave them, and...

...Blog Posts Read Our Primer on Optogenetics by Derek P. Simon Read Our Interview with Ed Boyden Resources...

...potential. BioTechniques 26:112–115.Marino JH; Cook P; and Miller KS. 2003. Accurate and statistically verified...

...suitable for high throughput applications. Trepte P, et al. J. Mol. Biol. 2015. PubMed PMID: 26264872 ...Text. Seeliger MA, Young M, Henderso MN, Pellicena P, King DS, Falick AM, and Kuriyan J. Protein Sci. 2005...

...Furthermore, they find that during stress, mRNAs in P-bodies are translationally repressed whereas the nonsequestered... has developed rapid-response luciferase (firefly P. pyralis) reporter plasmids for use in high-throughput...

... Schaepe, J., Du, P. P., Lotfy, P., Bassik, M. C., Bintu, L., Bhatt, A. S., & Hsu, P. D. (2022). Systematic... 29556040 Chen, P. J., Hussmann, J. A., Yan, J., Knipping, F., Ravisankar, P., Chen, P., Chen, C., Nelson...target DNA PCR P olymerase C hain R eaction; Used to amplify a specific sequence of DNA pegRNA P rime E dit...Kleinstiver, B. P., Prew, M. S., Tsai, S. Q., Topkar, V. V., Nguyen, N. T., Zheng, Z., Gonzales, A. P. W., Li,...Manchado, E., Concepcion, C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman,...Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J. M., Terns, R. M., Terns, M. P., White, M. F., Yakunin.... V., Randolph, P. B., Davis, J. R., Sousa, A. A., Koblan, L. W., Levy, J. M., Chen, P. J., Wilson, C....

.... H. J., DiBerto, J. F., Giguere, P. M., Sassano, F. M., Huang, X. P., Zhu, H., Urban, D. J., White, K.../10.1117/1.NPh.11.2.021005 PMID: 38450294 Coward, P., Wada, H. G., Falk, M. S., Chan, S. D., Meng, F.,...15765260 Farrell, M. S., Pei, Y., Wan, Y., Yadav, P. N., Daigle, T. L., Urban, D. J., Lee, H. M., Sciaky...Sciaky, N., Simmons, A., Nonneman, R. J., Huang, X. P., Hufeisen, S. J., Guettier, J. M., Moy, S. S., Wess...Bonaventura, J., Lesniak, W., Mathews, W. B., Sysa-Shah, P., Rodriguez, L. A., Ellis, R. J., Richie, C. T., Harvey...j.isci.2025.112022. PMID: 40092615 Magnus, C. J., Lee, P. H., Atasoy, D., Su, H. H., Looger, L. L., & Sternson..., Y., Oyama, K., Ji, B., Takahashi, M., Huang, X. P., Slocum, S. T., DiBerto, J. F., Xiong, Y., Urushihata...

... M., Beyrière, F., Tsunoda, S. P., Mattis, J., Yizhar, O., Hegemann, P., & Deisseroth, K. (2008). Red-...Emiliani, V., Entcheva, E., Hedrich, R., Hegemann, P., Konrad, K. R., Lüscher, C., Mahn, M., Pan, Z. H....Wietek, J., Beltramo, R., Scanziani, M., Hegemann, P., Oertner, T. G., & Wiegert, J. S. (2015). An improved...R., Ramakrishnan, C., Huguenard, J. R., Hegemann, P., & Deisseroth, K. (2011). Neocortical excitation/...21796121 Yizhar, O., Fenno, L., Zhang, F., Hegemann, P., & Diesseroth, K. (2011). Microbial opsins: a family...

...for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a. K. phaffii ). POMBOX MoClo YTK Yeast...MoClo-YTK toolkit for protein expression and secretion in P. pastoris (a.k.a. K. phaffii ). GoldenPiCS Kit Yeast...Sauer 62 plasmids for advanced strain engineering in P. pastoris (a.k.a. K. phaffii ), including overexpression... CRISPR/Cas9 mediated genome editing in the yeast P. pastoris (a.k.a. K. phaffii ). NT-CRISPR Plasmid ...

...27984732 Doman, J. L., Sousa, A. A., Randolph, P. B., Chen, P. J., & Liu, D. R. (2022). Designing and executing...CRISPR ( C lustered R egularly I nterspaced S hort P alindromic R epeats) is a powerful system that enables...Dixit, A., Parnas, O., Li, B., Chen, J., Fulco, C. P., Jerby-Arnon, L., Marjanovic, N. D., Dionne, D., ...Zuris, J. A., Thompson, D. B., Shu, Y., Guilinger, J. P., Bessen, J. L., Hu, J. H., Maeder, M. L., Joung, ...

...Hinrichs, C., Highfill, S. L., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide....2016.17 PMID: 27110581 Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M....Sabatini, D. M., Chen, I. S., Hahn, W. C., Sharp, P. A., Weinberg, R. A., & Novina, C. D. (2003). Lentivirus-delivered...12649500 Timms, R. T., Tchasovnikarova, I. A., & Lehner, P. J. (2018). Differential viral accessibility (DIVA...

...new window) Bulcha, J. T., Wang, Y., Ma, H., Tai, P. W. L., & Gao, G. (2021). Viral vector platforms within...Custers, J., Vellinga, J., Hendriks, J., Jahrling, P., Roederer, M., Goudsmit, J., Koup, R., & Sullivan...new window) Mendonça, S. A., Lorincz, R., Boucher, P., & Curiel, D. T. (2021). Adenoviral vector vaccine...in a new window) Rosewell, A., Vetrini, F., & Ng, P. (2011). Helper-dependent adenoviral vectors . Journal...

...Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S., Reier, P. J., Mandel, R. J., & Muzyczka, N. (...T., Inaba, T., Mizukami, H., Ozawa, K., & Colosi, P. (2004). The adenovirus E1A and E1B19K genes provide...Link opens in a new window) McCarty, D. M., Monahan, P. E., & Samulski, R. J. (2001). Self-complementary ...

...Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR) systems, which form an...

...vectors Forward Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element Reverse pTrcHis Forward GAGGTATATATTAATGTATCG...

... 2 J2, TCRGJ2 TRGJP T cell receptor gamma joining P JP, TCRGJP TRGJP1 T cell receptor gamma joining P1... External Resouces Immport : Bhattacharya S, Dunn P, Thomas CG, Smith B, Schaefer H, Chen J, Hu Z, Zalocusky...