Skip to main content

We narrowed to 942 results for: ina

Showing: 161 - 180 of 942 results
  1. Protocol - How to Purify DNA from an Agarose Gel

    Type
    Protocol
    ...band to cut without having DNA in other lanes contaminating your sample. To accomplish this, it is best ...each buffer to add during the DNA isolation step. Finally, you will want to isolate the DNA from the gel....
  2. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...of the buffer will evaporate and thus alter the final percentage of agarose in the gel. Many people prefer...mins. Optional : Add ethidium bromide (EtBr) to a final concentration of approximately 0.2-0.5 μg/mL (usually...
  3. Western Blot

    Type
    Protocol
    ... Antibody Guide Immunocytochemistry Protocol Recombinant Antibody Purification Protocol Introduction Western...Assay Kit or other preferred method for protein determination. Prepare a 50:1 Reagent A to Reagent B dilution...
  4. Kit Free RNA Extraction

    Type
    Protocol
    ...equipment, and reagents RNase-free (Use an RNase decontamination solution, such as RNaseZap® or RNase AWAY®,...microcentrifuge tubes, 4 mL polypropylene tubes RNase decontamination solution like RNase AWAY® or RNaseZAP® Isopropanol...
  5. Adenovirus Guide

    Type
    Guide
    ...carryover from the HV in final viral preparations. Several methods to avoid HV contamination have been developed...in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then... other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized...vectors for recombinant adenoviral vector production that do not contain GFP. Recombinant adenoviral vector...heavily-spliced transcripts flanked by two inverted terminal repeats (ITRs). Adenoviral genes are divided into...Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations, which is how they...information about AAVs, read our AAV guide . Recombinant Adenoviral Vectors Wild-type adenoviruses have...
  6. CRISPR Guide

    Type
    Guide
    ... catalyze cytidine deamination instead of (or in addition to) adenosine deamination, producing cytosine...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...interesting adaptive immune response that detects and eliminates foreign DNA, which scientists have modified for...Overview of the basic CRISPR mechanism. CRISPR was originally employed to knock out target genes in various...SpCas9, has one active nuclease domain and one inactivated one, allowing it to generate DNA nicks by cutting...cutting only one strand. Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease...backbone HypaCas9 — increase Cas9 proofreading and discrimination evoCas9 — decrease off-target effects xCas9...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Guide . Recombinant AAV Vectors Wild-type AAVs have been modified by researchers to create recombinant adeno-associated...diversity of diseases such as inherited retinal disease, spinal muscular atrophy, hemophilia A and B, and...frames, Rep and Cap, flanked by two 145 bp inverted terminal repeats (ITRs). The Rep region encodes four non-structural...Parvoviridae family. AAVs were discovered as a contaminant of adenovirus preparations, which is how they...in order to deliver genetic cargo into cells. Recombinant AAV constructs are designed by replacing the ...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination deficient bacterial strains, such as NEB Stable...
  8. Molecular Biology Reference

    Type
    Guide
    ...field of recombinant DNA, in which many identical DNA fragments can be generated. The combination of a DNA...Origins of Molecular Genetics The Genetic Code Recombinant DNA Working with Plasmids Plasmid Elements Types...chromosomes, which are composed of DNA. These findings culminated in the central dogma of molecular biology, that...nucleotides, termed a codon. There are 64 codon combinations and only 20 natural amino acids, so multiple...encode for synthetic amino acids. Plasmids and Recombinant DNA Technology Chemistry techniques enable the...isolate one specific DNA sequence. The field of recombinant DNA technology has overcome this obstacle by ... reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA...
  9. Molecular Cloning Techniques

    Type
    Guide
    ...BioRender.com. Gateway Recombination Cloning Gateway cloning is a recombination-based cloning method. ...Then you can use bacterial recombination to easily move it into any destination plasmid that fits your experimental...Resources Molecular cloning, or the creation of recombinant DNA, is an essential process used in scientific... popular cloning methods for the creation of recombinant DNA. Restriction Enzyme Cloning Restriction enzyme...one plasmid into another is done via a single recombination reaction, drastically simplifying the process...plasmid must already be surrounded by specific recombination sites — similar to restriction enzyme cloning...rapidly shuttled into any compatible Gateway destination vector, which contains attR sites, via LR clonase...
  10. Optogenetics Guide

    Type
    Guide
    ...optogenetics workflows (such as laser or LED illumination), systemic injection of a small molecule is ...closing of the channel 470 (activation) 590 (inactivation) ReaChR Red-activatable variant of CrChR2 590... 590 ChRmine Red-shifted channelrhodopsin from Tiarina fusus ; variants include rsChRmine (further red-shifted...chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal activity...adapted to control many protein functions, including kinase activity, localization, gene editing, transcriptional...fragment of a protein of interest, such as Cre recombinase, is fused to Cry2 and the other fragment to CIB1...Homodimerizes and binds to DNA upon blue light illumination, reverses in dark 450–495 iLID Improved light-inducible...
  11. Modular Cloning Guide

    Type
    Guide
    .... lipolytica . EXPRESSYALI Yeast Expression Irina Borodina Plasmids for assembly of single and multi-gene...tags, 6 CDSs, 9 terminators, 4 nonfunctional "dummy" parts, 34 backbones, and 6 destination vectors for use...method for creating many plasmids from different combinations of a common set of components (Weber et al.,...basic parts (promoters, UTRs, coding sequences, terminators, etc.) flanked by fusion sites into individual... signal peptide, a protein-coding gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules... only by the ability of E. coli to maintain the final plasmid after transformation. Figure 1: Overview...chloroplast-specific genetic modules, including destination vectors specific for tobacco ( N. tabacum ) or...
  12. Lentiviral Vector Guide

    Type
    Guide
    ...regulatory genes, accessory genes, and the long-terminal repeats (LTRs) necessary for integration. Not ... a heterologous promoter (often CMV or RSV), eliminating the need for transactivation by Tat. Most third-generation...contain a deletion in the 3’ LTR to make them self-inactivating (SIN). This deletion is transferred to the 5...incompetent by using four plasmids instead of three and eliminates the requirement for Tat. Always includes deletion...deletion in the 3' LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable...
  13. Sequencing Primers

    Type
    Guide
    ...TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator Reverse Other Common Sequencing...' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC CYC1 transcriptioin termination signal/td> Reverse...TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator Reverse Tac promoter GAGCGGATAACAATTTCACACAGG...information on molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular Biology...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...GCAAATGGCATTCTGACATCC For Pichia vectors with AOX1 terminator Reverse 5'AOX1 GACTGGTTCCAATTGACAAGC For Pichia...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit...
  14. Antibody Guide

    Type
    Guide
    ...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody... binding site. This process, known as V(D)J recombination, allows for a wide variety of antibodies to ...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...
  15. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...strand of RNA contains packaging genes and the long-terminal repeats (LTRs) necessary for integration. Wildtype...with certain cloning methods (such as a Gateway destination vector), so be sure to confirm your chosen plasmid... When cloning your plasmids, be sure to use recombination-deficient bacteria strains, such as NEB Stable... strains reduce the frequency of homologous recombination of unstable regions, like the LTRs found in ...engineered to stably express gag-pol and/or env , eliminating the need to deliver these genes on separate plasmids...envelope and packaging plasmids. Unless multiple recombination events occur between the packaging, envelope...that have been deposited with Addgene are self-inactivating (SIN). These plasmids have a deletion in the...
  16. Protocol - How to Design Primers

    Type
    Protocol
    ... primers) or too short. Short primers produce inaccurate, nonspecific DNA amplification product, and long...
Showing: 161 - 180 of 942 results