Skip to main content
Addgene

We narrowed to 12 results for: apc

Showing: 1 - 12 of 12 results
  1. Antibodies 101: Flow Compensation

    Type
    Blog Post
    ...applied to APC-Cy7 against APC to correct for this bleed. A compensation value of 3.7 for APC into APC-Cy7 applied...you will need compensation between APC and APC-Cy7; PE and PE-Cy7; APC-Cy7 and PE-Cy7; or BV421 and BV51...voltages.  Figure 1A shows a single-color APC control, with APC and APC-CY7 plotted against each other. Since... out of APC-Cy7. After increasing the compensation values for APC against APC-Cy7, the populations are...only be positive for APC, yet it seems as if the beads are also positive for APC-Cy7. You therefore would...would say that APC is “bleeding,” or spilling over, into APC-Cy7 channel and needs to be compensated out... showing an APC single-color control sample before (A) and after (B) compensation with APC-Cy7. The positive...
  2. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ...Figure 3), we see that APC-Cy7 is excited at a lower efficiency than APC. While APC's global excitation maximum...conjugated single fluorophores, like APC-Cy7. Conjugating Cy7 to APC results in a higher-wavelength emission... that excites at 750 nm, APC-Cy7 would show a much brighter signal, while APC would show no signal at ...Figure 3: Excitation and emission spectra for APC and APC-Cy7. While the excitation spectra of both fluorophores...through the actual APC-Cy7 fluorophore but displays an emission spectrum that overlaps with APC-Cy7. Therefore...through the APC-Cy7 parameter in the cytometer's software. It also means we should exclude APC-Cy7 from ...emission spectrum compared to APC. This happens due to a process called Fluorescence Resonance Energy Transfer...
  3. Antibodies 101: Flow Cytometry Controls

    Type
    Blog Post
    ...single color control for the APC channel. B) and C) A flow plot showing an APC single color control prior...staining for anti-mouse Ly6C in APC with the IgG2c subclass, you will use the APC IgG2c isotype control). The...compensation (B) and after compensation (C) with APC-Cy7.   FMOs FMO stands for fluorescence minus...
  4. Cancer and the Immune System: Deciphering the Relationship

    Type
    Blog Post
    ...: Suppressing Function Antigen presenting cells (APCs) that would normally alert the rest of the immune...growth factor beta (TGFβ) and IL-10 that suppress APCs. T cells that would normally attack the cancer cells... turns off T cell function upon interaction with APCs. Furthermore, tumor cells alter their cell-surface...proximity to the tumor; chemokine-aided activation of APCs produces modified dendritic cells (DCs) and macrophages...
  5. Antibody Guide

    Type
    Guide
    ...experiments 4-color flow panel: BV421, FITC, PE, and APC 4-color microscopy panel: DAPI for nuclei, AF488,...
  6. Validated gRNA Sequences

    Type
    Collection
    ...TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286 Voytas APC H. sapiens GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S....
  7. Antibody Guide

    Type
    Collection
    ...experiments 4-color flow panel: BV421, FITC, PE, and APC 4-color microscopy panel: DAPI for nuclei, AF488,...
  8. Immunology Research Plasmids and Resources

    Type
    Collection
    ...antigens on the surface of antigen presenting cells (APC) including dendritic cells and macrophages. Antigen...I and class II molecules found on the surface of APC. BCR Signaling B cells mediate humoral immunity through...I and class II molecules found on the surface of APC. Symbol Name Synonyms ADRM1 adhesion regulating molecule...receptor 1 FLJ41949, HVR1, II, PACAP-R-2, RDC1, VAPC1, VIPR, VIRG, VPAC1, VPCAP1R VIPR2 vasoactive intestinal...
  9. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Zinc Cytosolic Cyan-Yellow Zinc FRET sensors ZapCV2 and ZapCV5 Droplet Microfluidic Flow Cytometer For Sorting...Palmer Zinc Cyan-Yellow Zinc FRET sensors ZapCY1 and ZapCY2, Golgi or ER targeted Measuring steady-state...
  10. COVID-19 Resources

    Type
    Collection
    ...2020.05.04.20091231 (Link opens in a new window) AapCas12b plasmid from the Abudayyeh-Gootenberg lab. A one-enzyme...
Showing: 1 - 12 of 12 results