We narrowed to 5 results for: apc
-
TypeCollection...TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286 Voytas APC H. sapiens GAAGCGGGCAAAGGGGCGAC 58780 cut/nick S....
-
Antibody Guide
TypeCollection...experiments 4-color flow panel: BV421, FITC, PE, and APC 4-color microscopy panel: DAPI for nuclei, AF488,... -
Immunology Research Plasmids and Resources
TypeCollection...antigens on the surface of antigen presenting cells (APC) including dendritic cells and macrophages. Antigen...I and class II molecules found on the surface of APC. BCR Signaling B cells mediate humoral immunity through...I and class II molecules found on the surface of APC. Symbol Name Synonyms ADRM1 adhesion regulating molecule...receptor 1 FLJ41949, HVR1, II, PACAP-R-2, RDC1, VAPC1, VIPR, VIRG, VPAC1, VPCAP1R VIPR2 vasoactive intestinal... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Zinc Cytosolic Cyan-Yellow Zinc FRET sensors ZapCV2 and ZapCV5 Droplet Microfluidic Flow Cytometer For Sorting...Palmer Zinc Cyan-Yellow Zinc FRET sensors ZapCY1 and ZapCY2, Golgi or ER targeted Measuring steady-state... -
COVID-19 Resources
TypeCollection...2020.05.04.20091231 (Link opens in a new window) AapCas12b plasmid from the Abudayyeh-Gootenberg lab. A one-enzyme...