...tag neurons activated by opioid withdrawal with tdTomato and assessed cFos expression. She will explore...periaqueductal gray (PAG), with red neurons expressing tdTomato and green neurons expressing cFos. Image from ...

...targeted tdTomato and pre-synaptic targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE...

...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC.  The AAV9 is so strong that...

... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action...

...37825  AAV1 pAAV-CAG-GFP 59462  AAV2 pAAV-CAG-tdTomato (codon diversified) 114472  AAV5, AAV8 pAAV-...

...are available for dual expression of cytoplasmic-tdTomato and Synaptophysin-GFP. Synapse targeting GCaMP6s...

...usually provided by red fluorescent proteins such as tdTomato or RFP or blue fluorescent proteins like Cyan....

...different thermal quenching rates (mNeonGreen and tdTomato), they produce a temperature sensor that significantly...

...Yellow-orange fluorescent proteins like TagRFP, tdTomato, DsRed, the mKate series, or tdKatushka2 (Drobizhev...

.... Using the FAST system, Ye’s lab could edit a tdTomato fluorescent reporter gene in mice using Minicircle...

... vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be...

...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance...

...GCaMP6f/s Ca sensors and separate nuclear localized dTomato fluorophore Ting Lab GCaMP6 Plasmids 2014 Jonathan...

...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...

...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1 Boyden Inhibitory: ...

... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV....Optogenetics AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Ed Boyden AV-5-PV2527 99039-AAV5 pAAV-CamKII-ArchT-GFP... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...

... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission...

...Dorus Gadella 37351 pQC membrane TdTomato IX Membrane Palmitoylation TdTomato Connie Cepko 22479 FUmGW Membrane...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma Membrane CARMIL2 BH domain tdTomato John Cooper *Fusions to other...

...GTCCCCTCCACCCCACAGTG 48677 M-tdTom-SP Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48678 M-tdTom-ST1 Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG...GTCCCCTCCACCCCACAGTG protospacer 48679 M-tdTom-NM Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG...

... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals....