...transcription. The HIS3 reporter system (e.g. the Gateway-compatible bait Y2H plasmid pEZY202  from Yu-Zhu...

...used with Clover pGWF1 Cyan & Yellow Bacterial Gateway-compatible vector to express a gene of interest...

...Hai-Ning Du Lab. A set of pCS2+ backbone-based Gateway destination vectors (pGCS), bearing either amino...HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 Gateway-compatible Kit for Neurodegenerative Disorders ...

...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...

...; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148 , pAC149 ; gateway destination: pAC90...

...Recombinant Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium...

...pEZYshuttle Shuttle Modified pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang...

... which allows easy creation of long hpRNA with Gateway-based cloning and straightforward positive selection...

...Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway... Gateway® cloning is a recombination based cloning method. The benefit of Gateway® is that moving a piece...cassettes). Although gateway cloning is a simple and efficient cloning method, gateway vectors and recombination...Guide Genome Engineering Guide Restriction Enzyme Gateway TOPO Gibson Type IIS Ligation Independent Cloning...fragment must first be amplified with specific Gateway attB1 and attB2 sites attached to the 5’ and 3’...sequence. This fragment can then be cloned into a gateway donor plasmid which contains compatible attP sites...it can be rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via...

...For plasmids containing the ccdB gene, such as Gateway vectors, we recommend the ccdB Survival strain....

...in intact cells. The Gradia Lab has deposited a gateway vector with Addgene, where you can insert your ...

...assembly. Gersbach MuLE System Mammalian MultiSite Gateway recombination-based cloning of complex polycistronic...plasmids available for use in this Golden Gate and Gateway based assembly method: plasmids for assembly of...a single T-DNA binary vector of choice through Gateway recombination. Qi Multiplex Conditional Mutagenesis...

...used with Clover pGWF1 Cyan & Yellow Bacterial Gateway-compatible vector to express a gene of interest...

...vectors from the Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit...

...restriction sites but compatible with the Gateway® cloning system? Gateway® compatible vectors use recombination...yield of DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB survival...Invitrogen's website for more information on the Gateway® cloning system. What safety concerns surround ...

...GCATGATGACCACCGATATG 3' end of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse...

...specifically optimized for yeast Lindquist Lab Vectors - Gateway cloning; includes tagging with ECFP, EYFP, DsRed...

...fragment. Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you ...

...pENTR/D_creERt2 Cre-ERT2 - Tamoxifen inducible; Gateway entry vector none Entry Vector Zon 27493 pBT140...

...Perhaps the most widely used application of CcdB is GatewayTM cloning, where the ccdB gene serves as a counterselectable...