...sterility. Transducibility Some viral vectors are tested in vitro and in vivo for gene expression and/or...Mycoplasma The 293T and A549 lines are routinely tested for mycoplasma contamination using the protocols...-3 weeks post-thaw, cell culture supernatant is tested for mycoplasma contamination. To date, Addgene ...

...pooled libraries . New and Noteworthy: Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human...Nguyen et al. Mol Cell. 2023 May 18. Study how astrocytes interact with neurons with fluorescent sensors...Alzheimer’s disease and related disorders. The site curates information on useful resources such as: Antibodies...

...both the N and C terminus and induces mutation at rates much higher than the parental vectors. pC-GoldyTALEN... Features include (i) Esp3I (BsmBI) restriction sites for full compatibility with the Golden Gate TALEN... 21179091), as well as (v) distinct selection cassettes on pTAL7a and pTAL7b for enrichment of double-...

...vectors to efficiently modify nine different target sites in endogenous zebrafish genes (Hwang & Fu et al....targeted to a sequence of interest. Potential target sites can be identified using the publicly available, ...

...TALE activator binding sites in any given sequence of interest. The program generates graphical guides that...

...changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and...Insert Promoter Selectable Marker PI Publication Parasites Plasmid Gene/Insert Promoter Selectable Marker...

... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes...

...Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids dCas9-KRAB-MeCP2...

...target sites in cultured U2OS cells. Target Gene Name TALENs Full Target Site (5' to 3'; half-sites in CAPS...

...contains pre-assembled genetic circuits such as logic gates and higher level gene networks. Sensing and Signaling...Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter Selectable Marker ...

... length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more details...two-hybrid reporter system but have NOT yet been tested for activity as ZFNs in zebrafish. Target Gene ...

...microbial fields, including bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below...microbiology resources. The plasmids Addgene distributes cannot be used to reconstitute self-replicating...

...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...Center (CGC) - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold...

...interference demonstrates a role for Nramp1 in modifying susceptibility to type 1 diabetes. Kissler S, ...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. Plasmid Gene/Insert Promoter PI Publication 3xFLAG-dCas9...

... procedures. Additionally, because this virus integrates randomly into the host genome, it has the potential...interest, also can express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in the 3´-LTR). See...

...-CoV-2 detection assay for laboratory and home testing. Kellner, et al. bioRxiv 2020.06.23.166397 reverse... Endy and Philippa Marrack Labs. Point-of-care testing for COVID-19 using SHERLOCK diagnostics. Joung ...

...window) PMID: 10508514 2007 - Adrian Bird's lab demonstrates that Rett syndrome symptoms are reversible in...Joost Gribnau Xist 2lox/2lox Conditional Xist, Lox sites flanking exon 1,2,3 C57BL/6 Mouse line with conditional...

...staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova...