Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 61 - 80 of 156 results

  1. Ras Pathway

    Type
    Collection
    ...homolog RAC RAC1 RAC2 RAC3 Ras-related C3 botulinum toxin substrate (rho family, small GTP binding protein...

  2. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ...increased particle stability; however, the protein is cytotoxic precluding the long-term expression of lentiviral...vectors in producer cell lines. Identifying less toxic envelope proteins or envelope proteins that target...

  3. Plasmids 101: Control Plasmids

    Type
    Blog Post
    ...correct? Is the purified plasmid DNA viable? Or cytotoxic? How and where did things go wrong? The use of...reagents or the transfection process itself has any cytotoxic effects on the target cells. Another type of transfection...

  5. Targeting HIV-1 with CRISPR: Shock and Kill or Cut it Out?

    Type
    Blog Post
    ...produce viral proteins and die, either through cytotoxicity or the immune response. The second strategy ...expression. In cell lines that can produce HIV-1 toxic proteins, CRISPR/Cas9 SAM caused apoptosis, indicating...

  6. Tetracycline Inducible Expression

    Type
    Collection
    ...systems. Dox also has good tissue distribution, low toxicity, a known half-life (24 hours), and is compararably...

  7. CRISPR Guide

    Type
    Collection
    ...resistance to chemotherapy drugs, resistance to toxins, cell viability, and tumor metastasis. Currently...dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery RNA delivery of...

  8. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...problematic because excitation light can cause phototoxicity, autofluorescence, and perturb biological phenomena...the case of exciting cyan-excitable donors, phototoxicity. Another challenge to using FRET sensors comes...

  9. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ... overexpression of your gene and could lead to toxicity or trouble interpreting your results, while a ...low expression.  Finally, the risks of potential toxicity and/or off-target effects (e.g. recombinase-dependent...

  10. Which Fluorescence Microscopy Techniques is Best for Me?

    Type
    Blog Post
    ...high 3D spatial resolution while also avoiding the toxic effects of high light doses to the cells. Thin static... its fast temporal resolution and decreased phototoxicity. Lightsheet designs that allow for multi-view...

  12. Optogenetics + CRISPR, Using Light to Control Genome Editing

    Type
    Blog Post
    ...penetrate 5 mm past the surface of skin and is less phototoxic. Using the FAST system, Ye’s lab could edit a...editing, reduce off-target activity, and prevent cytotoxic effects. For a more detailed review, check out...

  13. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...  acrIIA3   Listeria monocytogenes  pCSW65 N/A (Toxic)   None N/A   acrIIA4 Listeria monocytogenes  ...  acrIIA3 Streptococcus pyogenes  pCSW24  N/A (Toxic) pJH375  No    ...

  14. Bacterial Expression Systems

    Type
    Collection
    ...which may aid disulfide bond formation or prevent toxicity. Compatible with Gateway cloning. pGTvL1-SGC 39188...

  15. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...efficiency of viral infection. However, polybrene is toxic to some cell lines. In these cell lines, substitute... media 24 hours after infection. TIP: If viral toxicity is observed in your cell line, you may decrease...

  17. Validated gRNA Sequences

    Type
    Collection
    ...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...
Showing: 61 - 80 of 156 results