We narrowed to 71 results for: Erf
-
TypeCollection...Plasmid Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones are plasmids containing...
-
Immunology Research Plasmids and Resources
TypeCollection...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8... -
Validated gRNA Sequences
TypeCollection... 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic GACAGAACGATGCGCTGAAT 68898 interfere S. pyogenes... 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes...AAACAAAACCTCATCAGGCA 68900 interfere S. pyogenes 26918244 Lu PcfiA GAAGCTCACTCCTTAGCACG 68899 interfere S. pyogenes ...74066 interfere S. pyogenes 26829286 Lu pgi C. glutamicum TTGCCTGGAAGTTTGAGTAATGAT 74067 interfere S. pyogenes...74068 interfere S. pyogenes 26829286 Lu pck C. glutamicum TCCAGTTCAGCAGTTCCTTATTCT 74069 interfere S. pyogenes...74070 interfere S. pyogenes 26829286 Lu pyk C. glutamicum ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes.... thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu BT1854 B. thetaiotaomicron... -
Viral Production
TypeCollection...protocols and performing rigorous quality control (QC). The specific QC experiments performed varies for ...of Pennsylvania Vector Core. Transfections are performed using the transfer plasmid, a plasmid encoding...and stored at -80 °C. Titer Titering is either performed by Addgene or by the University of Pennsylvania...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Pennsylvania Vector Core is (as of April 2016) also performed by droplet digital PCR (ddPCR). Quality Control.... To learn which specific QC experiments were performed on your lot, please contact us . Full sequencing...the Viral Genome Next-generation sequencing is performed on viral genomes isolated from the final AAV preparation... -
Plan Your Experiment
TypeCollection...Activation/interference Needs good primer design Western blot Knockouts Activation/interference Needs a ... nterspaced S hort P alindromic R epeats) is a powerful system that enables researchers to manipulate ...Selecting the genetic manipulation you plan to perform will help you narrow down which components you’...optimization can be challenging Prime Edit Repress or Interfere (CRISPRi) Reduce gene expression without permanently...effective than dCas9 alone for mammalian cell lines Interfere Activate (CRISPRa) Increase gene expression without...be effective, as the Cas9 bound to the DNA can interfere with transcription elongation. CRISPR Activation...between on-target and off-target activity. In a perfect world, your gRNA sequence would be an exact complement... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...vector, but their function (cut, nick, activate, interfere, etc.) is limited to that of the Cas protein present...have plasmids with Cas9 that can cut, activate, interfere, or nick. Selection , such as Puromycin or EGFP...Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere S. pyogenes Koffas BPK764 65767 Bacteria BsaI ...pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter 48962...pyogenes Bar Chen pBUN6I11 50580 Plant BsaI yes, interfere S. pyogenes Bar Chen pBUN411 50581 Plant BsaI ...pyogenes Hyg Chen pHSN6I01 50587 Plant BsaI yes, interfere S. pyogenes Hyg Chen pHSN501 50589 Plant BsaI ... -
Mammalian RNAi Tools
TypeCollection...Plasmids for mammalian RNA interference (RNAi) experiments at Addgene; browse by constitutive lentiviral...Tools for RNAi Browse Plasmids Resources RNA interference (RNAi) is an RNA-mediated gene silencing mechanism...as shRNA (short hairpin RNA) or siRNA (short interfering RNA). Delivery can occur via transfection or ...below. Figure 1: Overview of shRNA-mediated RNA interference. Created with BioRender.com. shRNA Plasmids ... Tuning silence: conditional systems for RNA interference . Nature Methods, 3 (9), 682–688. PubMed (Link..., L. (2023). A comprehensive review of small interfering RNAs (siRNAs): mechanism, therapeutic targets... -
Arf GTPase Family
TypeCollection... Plasmid Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... ...members of the RAS superfamily, though now have been argued to form their own superfamily (Klinger, et al...signaling activity. Figure 1: Locations of ARF superfamily members. Figure from Szutl, et al., 2019. Browse... window) Sztul, E., Chen, P., Casanova, J. E., Cherfils, J., Dacks, J. B., Lambright, D. G., Lee, F. S... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...colonies and inoculate into a mini-prep culture. Perform mini-prep for each sample and sequence each colony...may be scaled based on the required DNA yield. Perform maxi-prep for each CRISPR/Cas9 construct. Transfecting... cell type used at limiting dilution prior to performing this step to reliably obtain approximately 30...genomic DNA isolation may be utilized to be able to perform PCR in step 6.3 . Assemble a 20 μl PCR with the...reproducibility of results. To evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene...gene 7,8 . To evaluate the protein, perform an immunoblot using an antibody against the relevant protein... -
Antibody Guide
TypeCollection...signaling molecules, as some buffer components can interfere with the conjugate or conjugation process. Sodium...used as an antimicrobial agent. Other chemical interferences with conjugating reactions are possible. It ... antibody to specifically bind to a protein is powerful, but in order to utilize it in the lab, researchers...fluorophores. Horseradish peroxidase (HRP) HRP performs a chemiluminescent reaction in the presence of...activated and its output measured. This method can be performed using the indirect detection method via a conjugated...protein complexes for downstream analysis. They are powerful tools for understanding protein or protein interactions...above. Reverse the crosslink, isolate DNA, and perform downstream analysis. Special considerations One... -
CRISPR Plasmids - Plants
TypeCollection...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target...pyogenes Bar Chen 50580 pBUN6I11 OsU3 BsaI yes, interfere S. pyogenes Bar Chen 50582 pBUN501 AtU6-26 BsaI...pyogenes Hyg Chen 50587 pHSN6I01 AtU6-26 BsaI yes, interfere S. pyogenes Hyg Chen 50589 pHSN501 AtU6-26 BsaI... -
Fluorescent Protein Guide: Biosensors
TypeCollection... High-performance GFP-based calcium indicators (Constitutive or Cre-dependent) High-performance calcium...:547-63. Sergio Grinstein pH Superfolder pHluorin pH sensor A superfolder variant of pH-sensitive pHluorin...chloride sensitivity, photostability and reduced ph interference demonstrates augmented transmembrane chloride...Citron/Citroff), mitochondrial or cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically...Voltage Voltage Sensitive Fluorescent Protein (VSFP/Butterfly) Knopfel Lab VSFP Plasmids Thomas Knopfel Voltage... Near-infrared fluorescent voltage indicator nirButterfly Screening and Cellular Characterization of Genetically... -
CRISPR Plasmids - Repress Gene Expression
TypeCollection... CRISPR Interfere CRISPR Plasmids: Interfere Browse CRISPR Plasmids By Function...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target... -
CRISPR Guide
TypeCollection...scalable genome editing technologies, making CRISPR perfect for genome-wide screens. This guide will provide.... Ideally, a gRNA targeting sequence will have perfect homology to the target DNA with no homology elsewhere...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 - increases fidelity with reduced nuclease...for sequences > 10 kb! Currently, these systems perform best in bacterial species, but newer versions engineered...More robust transcriptional repression (CRISPR interference, or CRISPRi) or activation (CRISPRa) of downstream...chromosome. Browse Plasmids: Activate , Repress/Interfere Epigenetic Modifications Using CRISPR A variation...transcription of a target gene CRISPRi CRISPR Interference; using a dCas9 or dCas9-repressor with a gRNA... -
Antibody Production
TypeCollection...not compatible for use in live cells and will interfere with conjugation. For applications such as these...recommended applications. The specific QC experiments performed varies for each antibody catalog item. Whenever...Whenever possible, the experiment is performed in parallel with a previous lot of recombinant antibody or the.... To learn which specific QC experiments were performed on your lot, please email [email protected] . Immunocytochemistry... -
CRISPR Plasmids - Yeast
TypeCollection...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target... -
AAV Packaged on Request
TypeCollection...this time, we amplify DNA, produce the prep, and perform comprehensive quality control processes to make...whether the item can be packaged. Addgene does not perform functional or in vivo testing. We recommend that...chosen AAV plasmid for more information on its performance. ID Plasmid Gene/Insert Promoter PI Additional... -
CRISPR Plasmids - Bacteria
TypeCollection...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target... -
CRISPR Plasmids - Mammalian Expression
TypeCollection...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target... -
Genetic Code Expansion
TypeCollection...Mammalian TAA Simon Elsaesser 157925 pMAH-POLY-eRF1(E55D) POLY-eRF1(E55D) E. coli para-substituted phenylalanine...182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA...