Skip to main content
Addgene
Showing: 1 - 20 of 49 results
  1. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ... CRISPR Visualize CRISPR Plasmids: Visualize Genomic Loci ... labeling and visualization of genomic loci. CRISPR...Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty...proteins (RBPs) tagged with fluorescent proteins to visualize targeted genomic loci. CRISPR imaging has numerous...well as chromosome painting in living cells. Visualizing a specific genomic locus requires recruitment...chromosome-specific repetitive loci can be efficiently visualized in living cells using a single gRNA that has ...
  2. Antibody Guide

    Type
    Collection
    ...Chromatin immunoprecipitation (ChIP) Visualization - used to visualize protein location. Includes: Immunofluorescence...immunoprecipitation. Antibody Applications - Visualization Methods Visualization methods such as immunofluorescence...individual assay conditions. Controls for visualization methods Visualization methods should employ positive, negative...Specificity Other Affinity Reagents Handling Visualization Signal Amplification Application Overview Quantification...Quantification Methods Capture Methods Visualization Methods Cell Sorting Methods Multiplex Assays Selection...accessible to antibodies. Detection of sdAbs is usually achieved by conjugation of a signaling molecule...before conjugating your antibodies. Antibody Visualization The ability of an antibody to specifically bind...
  3. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ... Because the G is only one base, the Zhang lab usually adds it when they order the oligo. If your spacer...single-allelic and bi-allelic cells. Single-allelic cells usually make up the majority in culture unless the targeting...S0092-8674(13)01015-5 As for target selection, we usually pick 3-6 guides around the region to find the most...consider using ssDNA oligo as donor template, it's usually more efficient than plasmid donor. Typical design...CRISPR protospacer target in the HR template, you usually would need to make mutations of the HR template...probably a single stranded DNA (ssDNA) oligo which usually work better than plasmids. For ssDNA oligo design...PCR reaction. The gDNA extracted in this way is usually more concentrated than using other kits like the...
  4. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...stimulus preference after monocular deprivation in the visual cortex. Science. 2016 Jun 10;352(6291):1319-22....sensors Red fluorescent CEPIA indicators for visualization of Ca(2+) dynamics in mitochondria. Sci Rep....genetically encoded fluorescent biosensor for visualization of acetyl-CoA in live cells. Cell Chem Biol.... (MaLion) RGB-color intensiometric indicators visualize spatiotemporal dynamics of ATP in single cells...Development of red genetically encoded biosensor for visualization of intracellular glucose dynamics. Cell Chem...Glutamine FLIPQTV3.0 glutamine sensor variants Visualization of glutamine transporter activities in living... for NADH/NAD+ ratio Cytosolic NADH-NAD Redox Visualized in Brain Slices by Two-Photon Fluorescence Lifetime...
  5. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ... SNAP, CLIP, ACP or MCP tagged plasmids for visualization of proteins inside cells....based on SNAP-, CLIP-, ACP-, and MCP-tags for visualization of proteins inside living or fixed cells. The...research community. Key features: Allows for visualization of multiple proteins simultaneously with dual... derivatives to allow for dual labeling and visualization of complementary protein function or localization...
  6. CRISPR Guide

    Type
    Collection
    ...Overview of visualizing genomic loci with fluorophores using CRISPR Browse Plasmids: Visualize Purify Genomic...unique gRNAs. gRNA design for CRISPR libraries is usually optimized to select for gRNAs with high on-target... become a flexible tool to activate, repress, visualize, and isolate genes. Activation or Repression of...modification using CRISPR Browse Plasmids: Epigenetics Visualizing Genomic Loci Using Fluorophores CRISPR imaging...multiple targets simultaneously. CRISPR imaging can visualize chromatin and RNA dynamics in live cells. Labeling... painting, and RNA tracking in living cells. Visualizing a specific genomic locus requires recruitment...Chromosome-specific repetitive loci can be efficiently visualized in living cells using a single gRNA that has ...
  7. Bacterial Expression Systems

    Type
    Collection
    ...Bacterial Expression Systems Genome Engineering Visualization and Tagging Purification Controlled Expression...Reporter Plasmids Reporter Plasmids Tagging and Visualization Purification Controlled Expression Reporter ...optimized FokI endonuclease domain. Return to Top Visualization and Tagging If you’d like to know where your...interest does when expressed in vivo . Plasmid ID Visualization Technique/Tag PI Purpose Empty Backbones with...
  8. Lentiviral Prep Service

    Type
    Collection
    ...dynamics. This library expresses EGFP for easy visualization via direct fluorescence. Morris 115644 Morris...dynamics. This library expresses EGFP for easy visualization via direct fluorescence. Morris 115645 Morris...dynamics. This library expresses EGFP for easy visualization via direct fluorescence. Morris Control Lentivirus...
  9. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty...Insert Promoter Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9) fused to...to a fluorescent protein (FP) can help visualize specific genomic loci using fluorescent microscopy in...
  10. Depositor Collections

    Type
    Collection
    ...collections of antibody, CRISPR, disease research, visualization, protein expression, synthetic biology, and ...Resource Center TREAT-AD Plasmid Collection Visualization Michael Davidson Fluorescent Protein Collection...
  11. CRISPR Plasmids and Resources

    Type
    Collection
    ...given genomic locus. Visualize CRISPR fluorescence methods can be used to visualize genomic loci. gRNAs...
  12. TALEN Plasmids and Kits

    Type
    Collection
    ...mammalian expression of fluorescent TAL effectors to visualize subcellular positioning of target DNA sequences...sequences in living cells (TALE-mediated Genome Visualization [TGV]). pTALYM3 and pTALYM4 contain TALE fused...
  13. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...Featured article from Journal of Visualized Experiments (JoVE) about genomic deletions in mammalian cell...to present a video reprint from the Journal of Visualized Experiments (JoVE). The video publication by ...
  14. Validated gRNA Sequences

    Type
    Collection
    ... MUC4 H. sapiens GTGGCGTGACCTGTGGATGCTG 51025 visualize S. pyogenes 24360272 Qi MYOD1 H. sapiens TGGCCTCCCTCCCTGCCCGGTAG...telomeres H. sapiens GTTAGGGTTAGGGTTAGGGTTA 51024 visualize S. pyogenes 24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA...
  15. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty...
  16. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty...
  17. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty...
Showing: 1 - 20 of 49 results