We narrowed to 41 results for: LOR
-
TypeCollection...below. Color is used for clarity and does not indicate a specific relationship. p53 Pathway Color is used...
-
Kazuhiro Oka Lentiviral Vectors
TypeCollection...Lentiviral Vectors deposited by Kazuhiro Oka from the Baylor College of Medicine Gene Vector Core...Vector Core (Link opens in a new window) of the Baylor College of Medicine have deposited a series of ... -
Luciferase Plasmid Collection
TypeCollection...Explore Addgene's collection of luciferase plasmids for gene expression assays and bioluminescent reporters...fluorophore can provide more flexibility in emission colors and imaging without the need for an illumination... -
CRISPR History and Development for Genome Engineering
TypeCollection...translational technologies. Biotechnology companies are exploring therapeutic applications of CRISPR to treat genetic...Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal loci in human ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol Marraffini... -
Michael Davidson Fluorescent Protein Collection
TypeCollection...Photoactivatable The lab of Michael Davidson from Florida State University has contributed their comprehensive... -
Fluorescent Protein Guide: In Vivo Imaging
TypeCollection... have high brightness and allow for single or multicolor imaging. Photo-activatable iRFPs can be turned... -
Institute for Protein Innovation
TypeCollection...anti-glypicans that accurately detect glypican presence and explore glypican function, providing a reliable and accessible... -
Optogenetics Plasmid Collection
TypeCollection... cells. Other microbial opsins, such as the Halorhodopsins, Archaerhodopsins and Leptosphaeria rhodopsins... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...George N, Krumm H, Johnsson K, Johnsson N. 2005. Multicolor imaging of cell surface proteins. J Am Chem Soc... -
CRISPR Plasmids - Prime Edit
TypeCollection... improve the efficiency of editing, including exploring new sources for the reverse transcriptase. Many... -
CRISPR Plasmids - Bacteria
TypeCollection...Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol yes, cut Marraffini 44251 pgRNA-bacteria BBa_J23119... -
Zebrafish Plasmid Collection
TypeCollection...Lab Zebrabow - Albert Pan and Alex Schier Labs. Multicolor fluorescent labeling in zebrafish Whole organism... -
Open Enzyme Collection
TypeCollection...E overhangs for Golden Gate assembly. Plasmids Explore the collection and order individual plasmids via... -
Fluorescent Proteins: FRET
TypeCollection...unimolecular FRET). Learn more about FRET on our blog and explore the tables below for plasmids and information to... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Yale University changed the way researchers can explore important questions surrounding serine phosphorylation... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection... Type Promoter PI Additional Addgene resources Explore our full catalog for plasmids expressing Cre recombinase... -
Optogenetics AAV Preps
TypeCollection...AAV collection, including channelrhodopsins, halorhodopsins, and more.... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Human Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library 178284 Knockout Green ... -
Validated gRNA Sequences
TypeCollection...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...