Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

Information

In Category

We narrowed to 73 results for: RON

Showing: 21 - 40 of 73 results

  1. AAV Molecular Tools

    Type
    Collection
    ...used for neurophysiology experiments, including neuronal connectivity labeling. ID Name Expression System...TEVp EF1a-driven, Cre-dependent Cre-dependent, bicistronic expression of designer pro-taCasp3 and TEVp for...expression of Kir2.1 and mScarlet-KASH for silencing neurons 8 Ivo Spiegel Anterograde Transsynaptic Tracers...direction across synapses. Also see Monosynaptic Neuronal Tracers available at Addgene. ID Name Expression...protein to express in presynaptic glutamatergic neurons, Cre payload. Must use with AAV8-DIO-Reporter viruses...

  2. Bacterial Expression Systems

    Type
    Collection
    ...activity Fluorescence (GFPmut3a) and luminescence (lux operon) Gram-negative bacteria Attila Karsi 14080 pAKlux2...pAKlux2 Promoter activity Luminescence (lux operon) Gram-negative bacteria Attila Karsi 14076 pAKgfp1 Promoter...pMV306hsp+LuxG13 Promoter activity Luminescence (lux operon) Mycobacterium sp. Brian Robertson , Siouxsie Wiles...pMV306hsp+Lux Promoter activity Luminescence (lux operon) Mycobacterium sp. Brian Robertson , Siouxsie Wiles...pMV306G13+Lux Promoter activity Luminescence (lux operon) Mycobacterium sp. Brian Robertson , Siouxsie Wiles...78565 pCM18 Promoter activity Luminescence (lux operon) Vibrio cholerae James Kaper Additional Addgene...

  3. Biosensor AAV Preps

    Type
    Collection
    ...Boyden Voltage Reporter: Voltron 119036 pAAV-hsyn-flex-Voltron-ST Syn Voltron-ST none Cre dependent 1 ...Oxytocin (OT) Sensors GRAB_OT Voltage Sensors Archon Voltron JEDI-2P ASAP ATP Sensors iATPSnFR2 5-HT Sensors...pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 Syn axon-GCaMP6s bicistronic mRuby3 Constitutive 5, 9 Tian 112010 pAAV-hSynapsin1...Schreiter 172907 pGP-AAV-syn-FLEX-Volton2-ST-WPRE Syn Voltron2-ST none Cre dependent 1 GENIE Voltage Reporter...

  4. Validated gRNA Sequences

    Type
    Collection
    ...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...59724 cut S. pyogenes 25543152 Hanna BT1754 B. thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes...pyogenes 26918244 Lu BT1854 B. thetaiotaomicron ATTGAAGAACAAAAGCAGTT 68891 interfere S. pyogenes 26918244...

  5. Luciferase Plasmid Collection

    Type
    Collection
    ...contain introns Anthony Leung Return to Top Expression Constructs Luciferase driven by a strong constitutive...reporter reporter vector allowing the study of biscistronic promoters. Daniel Christophe 119760 pSGDlucV3.0...expression of firefly luciferase and iRFP720 from a bicistronic promoter Antonius Plagge 118017 pLX313-Firefly...for bioluminescent chemo-optogenetic control of neuronal signaling. TRUPATH Kit , ONE-GO Biosensors Kit...

  6. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...Resources SGC: www.thesgc.org SGC Toronto: www.thesgc.org/scientists/groups/toronto Protein Database (PDB): www.pdb.org...without restriction. Many SGC plasmids from the Toronto, Oxford and Stockholm sites have been deposited...the SGC Plasmid Collection By All Plasmids SGC Toronto SGC Oxford SGC Stockholm Bacterial Expression Plasmids...

  7. Optogenetics Plasmid Collection

    Type
    Collection
    ...specific neurons, often utilizing viral expression systems, to activate or deactivate these neurons in a .... When using these opsins as a tool to control neuronal activity, scientists generally attach a fluorescent... table below for the optogenetics plasmids for neuronal excitation and inhibition. For example, search...

  8. Antibody Guide

    Type
    Collection
    ... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential...

  9. Viral Production

    Type
    Collection
    ...Edward Boyden (Addgene viral prep # 84445-AAVrg). Electron Microscopy The ratio of empty to full (i.e., genome...representative vector preparations was quantified with electron microscopy after negative staining. Empty vector...appear darker than full vector particles. Figure 3: Electron micrograph of AAV vector preparation shows that...psPAX2 and pMD2.G packaging system developed by the Trono lab . Cell culture medium (OptiPro SFM) containing...

  10. Rett Syndrome

    Type
    Collection
    ..., an immortalized pre-neuronal cell line that can be differentiated into neurons Coriell Institute: Patient-specific...the location and type of MECP2 mutation can be a strong predictor of symptom severity. Broadly, early gene...and cell-specific differences and correlate with neuronal maturation. Hum Mol Genet . 11, 115–124. PMID:...

  11. Caltech Systemic Capsids

    Type
    Collection
    ...tropism - AAV.MaCPNS1, AAV.MaCPNS2 Cell type-biased: Neurons - AAV.CAP-Mac, AAV9-X1.1 For marmosets: Broad tropism... tropism - AAV.CAP-B22 Cell type-biased: Neurons - AAV.CAP-B10 Brain vascular cells - AAV.CAP-Mac For ...: Broad tropism - AAV-PHP.eB Cell type-biased: Neurons - AAV.CAP-Mac Brain vascular cells - AAV9-X1.1,...animal Brain vascular cells - AAV9-X1.1, AAV1-X1 Neurons - AAV.CAP-B10, AAV-PHP.N Broad - AAV-PHP.AX with...

  12. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...variable 91,948 Toronto KnockOut - Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut... 67989 Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753...Knockout Mouse Superti-Furga 3rd 6 2,384 Mouse Toronto KnockOut (mTKO) CRISPR Library 159392 159393 Knockout...

  13. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Filaments (neuronal) Nefm EGFP Anthony Brown 32909 pEGFP-mNFM Intermediate Filaments (neuronal) Nefm EGFP... proteins from the cell to the extracellular environment. Proteins are first translated at the endoplasmic...proteins that enter the secretory pathway require chaperones to help with folding or post-translational modification...

  14. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ... pseudotyped virus for SARS-CoV-2 and other coronaviruses using appropriate packaging plasmids. Use the...Nemazee lab - Pseudotyped virus protocol for coronaviruses (DOCX, 184 KB) Addgene Blog Posts Viral Vectors...COVID-19 Resources and Collections COVID-19 and Coronavirus Plasmids & Resources Ginkgo Bioworks COVID-19...

  15. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Optogenetics Ed Boyden AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-1-PV3447 59171-AAV1...Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-5-PV3447 59171-AAV5...-GFP Ed Boyden AV-9-PV3446 59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40...Karl Deisseroth AV-8-PV3706 62726-AAV8 pAAV-Syn-Chronos-tdTomato Ed Boyden AV-1-35507 35507-AAV1 pAAV-Ef1a-DIO...

  16. Plant Plasmids and Resources

    Type
    Collection
    ...includes a high efficiency intron-optimized SpCas9-coding gene, zCas9i, and an intronized Cas9 series of vectors...Cloning Chloroplast Toolbox for design of synthetic operons for chloroplast transformation and metabolic engineering...

  17. CRISPR Guide

    Type
    Collection
    ...general repair pathways: the efficient but error-prone non-homologous end joining (NHEJ) pathway and the...to the desired edit can increase efficiency. Synchronizing cells or modulating the cell cycle can help ...exhibit almost unidirectional insertions but are more prone to off-target insertions. And in the case of both...differentiation. The system is reversible, with a companion CRISPRon to undo repression using a TET1-dCas9 fusion. ... Gelsinger, D. R., Vo, P. L. H., Klompe, S. E., Ronda, C., Wang, H. H., & Sternberg, S. H. (2024). Bacterial.... 41 (7), 968–979. PMID: 36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang...

  18. Retrograde AAV viral preps

    Type
    Collection
    ...transgene delivery to projection neurons. Specific classes of projection neurons can be targeted by using this...Activator Optogenetics Edward Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics Edward Boyden 83898...

  19. Zhang Lab CRISPR Page

    Type
    Collection
    ...PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; ...pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in neurons. SpCas9 guide acceptor: The PX552 plasmid (#60958...-mediated expression of an sgRNA targeting the neuronal-specific gene NeuN. As a control they designed...

  20. Ginkgo Bioworks COVID-19 Collection

    Type
    Collection
    ...or sort buttons to find SARS-CoV-2 and common coronvirus plasmids based on: Gene insert (e.g. spike, envelope... Expression Systems Collection: COVID-19 and Coronavirus Plasmids & Resources , links to collections of...
Showing: 21 - 40 of 73 results