...control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD Receptor... and outcome in neurons. Table 2. Descriptions of PSAMs and their activity in neurons PSAM Ion Pore Domain...Outcome (in neurons) Reference PSAM4 Gly Varenicline, uPSEM 792, uPSEM 817 Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2019 PSAM Q79G,Q139G Gly PSEM 22S Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2011 PSAM L141F,Y115F Gly PSEM 89S Cl - influx Neuronal inhibition...and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference LMO3 sbGLuc...expressed. However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs...

...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ... silence neuronal activity 632 Halo/NpHR Light-driven inward chloride pump from Natronomonas pharaonis...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the... 470 Fluorescent Protein domains Dronpa based Light-inducible Dronpa mutant domains that associate and...activated and inactivated transgene expression in neurons. Front Neural Circuits. 6:47. PMID 22866029 Wietek...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...channelrhodopsin, fused to mCherry, is expressed in neurons (red dots). When exposed to light of the correct...

...Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter...have complex systems of gene regulation, like operons. Operons are a cluster of different genes that are ...together. Operon regulation can be either negative or positive. Negative repressible operons, are normally...transcription. The Lac operon in bacteria is an example of a negatively controlled operon. A positive repressible...repressible operon works in the opposite way. The operon is normally transcribed until a repressor/corepressor...Promoter from Lac operon araBad Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible...human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian...

...protocol available at the (Link opens in a new window) Trono lab website . Viral Production Schematic Frequently...species and cell types. For more information, see the Cronin, et al. article on different envelopes and their...protocol for using the popular cloning vector pLKO.1. Trono Lab Resources: Lentivectors Toolbox and Maps Standard...tropism of lentiviral vectors through pseudotyping. Cronin J, Zhang XY, Reiser J. Curr Gene Ther. 2005. 5(... by Retroviral Vectors. Zufferey R, Donello JE, Trono D, and Hope TJ. J Virol. 1999. 73(4):2886-92. PubMed...Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, and Naldini L. J Virol. 1998. 72(11):8463-8471...Mandel RJ, Bukovsky A, Quiroz D, Naldini L, and Trono D. J Virol. 1998. 72(12): 9873-9880. PubMed . Retroviruses...

...primer Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin... pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT...pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron, forward primer pMX-S1811 GACGGCATCGCAGCTTGGATACAC...

... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential...

...general repair pathways: the efficient but error-prone non-homologous end joining (NHEJ) pathway and the...to the desired edit can increase efficiency. Synchronizing cells or modulating the cell cycle can help ...exhibit almost unidirectional insertions but are more prone to off-target insertions. And in the case of both...differentiation. The system is reversible, with a companion CRISPRon to undo repression using a TET1-dCas9 fusion. ... Gelsinger, D. R., Vo, P. L. H., Klompe, S. E., Ronda, C., Wang, H. H., & Sternberg, S. H. (2024). Bacterial.... 41 (7), 968–979. PMID: 36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang...

...only a subset of genes, or very large (e.g. the Toronto KnockOut (TKO) library from the Moffat lab has ... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...

...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...

... as alter tropism. For example, AAV2/5 targets neurons that are not efficiently transduced by AAV2/2, ...

...mutated allele may be different owing to the error-prone nature of NHEJ. In HDR gene editing experiments,...

...controlling the level of insert expression (i.e., a strong promoter directs high expression, whereas weaker...