Skip to main content
Addgene
Showing: 21 - 40 of 58 results
  1. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... ACS Sens. 2020 Mar 27;5(3):814-822. Bas Teusink ATP (extracellular) ecAT3.10 extracellular ATP sensor... fast indicator evolved for two-photon microscopy. Cell. 2022 Aug 16. pii: S0092-8674(22)00916-3. Francois...Mammals. Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. Karl Deisseroth , INTRSECT 2.0 Project Calcium Expression...Mammals. Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. Karl Deisseroth , INTRSECT 2.0 Project Calcium Mitochondrial...Chromosome Condensation. Curr Biol. 2018 Feb 5;28(3):444-451.e6. Takeharu Nagai Magnesium MagFRET-1 Mg2...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...Learning. Cell. 2020 Dec 12. pii: S0092-8674(20)31612-3. Lin Tian Serotonin Serotonin (5-HT) sensor psychLight...
  2. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat Biotechnol . 32(3):279-84. PMID: 24463574 Fujita..., which together separate the individual crRNAs. (3) The tracrRNA and Cas9 nuclease form a complex with...Multiprotein Complexes in Human Cells. Cell Rep . 13(3):621-33. PMID: 26456817 Fu Y, Sander JD, Reyon D, ...Control of Gene Repression and Activation. Cell . 159(3):647-6. PMID: 25307932 Gilbert LA, Larson MH, Morsut...Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227 Zetsche B, Heidenreich M, ...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...
  3. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...S. pyogenes (PAM = NGG) 49410 pCFD3-dU6:3gRNA dU6:3 BbsI Injection or in vitro transcription Virmilion...Port 49411 pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription Virmilion...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...
  4. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ... actual oligo you should order is: 5'-CACCGN...N-3' 3'-CN...NCAAA-5' You need to add the CACC and AAAC...) is located? If there are other PAMs in the region, will they also be targeted? The Cas9 cuts 3-4bp upstream...)01015-5 As for target selection, we usually pick 3-6 guides around the region to find the most efficient...puromycin selection. You could then confirm this purification by performing a genotyping assay (such as Sanger...genomic DNA as template after performing gDNA purification and have tried conditions with 5% DMSO or without...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Why does...
  5. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...Arrays Engineering Method Full Target Site (5' to 3') Left half-site Right half-site CACNA1F OZ507 and...nucleases. Foley JE et al. Nat Protoc. . 2009. Dec 3. 4(12):1855-1867. PubMed PMID 20010934 ....OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa ldr (low...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN...
  6. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...inducible (Tet) expression miRNA and 3' UTR mRNA regulation pIS0 - 3'UTR segments of target genes can be... for gene expression Thy1.1 Mammalian pLKO.3 Thy1.1 - Lentiviral shRNA expression Gentamicin Varies...see more Gateway vectors) pCAP03-acc(3)IV - Facilitate the capture and expression of bacterial...plasmids containing only the elements needed for replication in the host cell and are designed for a user ...Protein Function: Viral Vector Delivery, Genome Modification, mRNA Regulation, and More Selectable Markers...collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids and Resources collection page...Additionally, tags are commonly added to aid in protein purification. Just remember to remove the stop codon for ...
  7. Qi Lab CRISPR Page

    Type
    Collection
    ...both plasmids in HEK293 cells could cause up to 2~3-fold repress on targeted fluorescent genes. These ... targeting repetitive sequence of human MUC4 exon 3 46915 pU6-sgGAL4-1 Human pSico-based U6 vector containing...Plasmid Description 44246 pdCas9-humanized A catalytically inactive, human codon-optimized Cas9 expression...expression plasmid 44247 pdCas9::BFP-humanized A catalytically inactive, human codon-optimized Cas9-BFP fusion...codon-optimized Cas9 constructs 44249 pdCas9-bacteria A catalytically inactive bacterial Cas9 expression plasmid 44250...
  8. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...741-6 Shemiakina et al. : Nature Communications, November 2012, Vol. 3 No. 1204 Wiedenmann et al. : Journal...pBAD-LSSmOrange - Bacterial Expression mKeima Red 440 620 3 6.5 4.4 hr Monomer pFA6a-link-yomKeima-CaURA3 - Yeast...dKeima-Red-N1 - Mammalian Expression LSSmKate1 463 624 3 3.2 1.7 hr Monomer pLSSmKate1-N1 - Mammalian Expression...HisB-PAmKate - Bacterial Expression PAiRFP1 690 717 3 Dimer pPAiRFP1-N1 - Mammalian Expression pBAD/HisB-PAiRFP1...HisB-PAiRFP1 - Bacterial Expression PAiRFP2 692 719 3 Dimer pPAiRFP2-N1 - Mammalian Expression pBAD/HisB-PAiRFP2... Vol. 11 No. 5, pp.572-8 Yu et al. : Nature Communications, May 2014 Vol. 15 No. 5, p. 3626 Do you have...
  9. Zebrafish Plasmid Collection

    Type
    Collection
    ...development (embryogenesis is complete in ~3 days), short generation time (~3 months), ease of care and breeding...Society (IZFS) - An organization that promotes and advocates for zebrafish research in the international research...
  10. Open Enzyme Collection

    Type
    Collection
    ...(exo-) DNA Polymerase I, Large (Klenow) Fragment (3'-5' exo-) 165512 pOpen-THEAQpolA Taq DNA Polymerase...MMLV) Reverse Transcriptase (RNAse H deactivated by 3 mutations) 165556 pOpen-MMLV_RT (lack H) Moloney Murine...polymerase chain reaction (PCR), cloning, isothermal amplification, reverse transcription of RNA into DNA, and ...for fixing damaged and degraded DNA prior to amplification, enzymes for cutting protein sequences to remove...then transform into E. coli for expression and purification ( pET28a-LIC or other pET vectors are recommended...
  11. Viral Production

    Type
    Collection
    ... that titers obtained using ddPCR are generally 2–3 fold higher than those achieved using the standard... appear darker than full vector particles. Figure 3: Electron micrograph of AAV vector preparation shows...minimized by using an endotoxin-free plasmid purification protocol. To minimize the immunogenic properties...posted on the material page for the corresponding catalog item (see maps section for images). Figure 2: AAV...typically prepared using endotoxin-free plasmid purification kits. Resources Browse lentiviral preps available...
  12. TALEN Plasmids and Kits

    Type
    Collection
    ...for in vitro synthesis of TALEN mRNAs. Both 5’ and 3’ Xenopus β-globin UTRs are included in the vector ...Gate TALEN Kit and are used in place of pTAL1, 2, 3, or 4. For both plasmids sequence positions 1214–2210...Golden Gate TALEN kit. The GoldyTALEN scaffold is truncated at both the N and C terminus and induces mutation...pC-GoldyTALEN directs expression of TALENs from a truncated CAGs promoter. RCIscript-GoldyTALEN is designed...in vitro mRNA synthesis from the T7 promoter. Truncations were introduced to the N- and C-terminus of the...Golden Gate TALEN 2.0 48705 pTAL7a Boris Greber Application of TALEN technology in hPSCs pTAL7a and pTAL7b...expression in mammalian cells, (iv) an improved, truncated TALE backbone architecture as established by Miller...
  13. CRISPR Plasmids - gRNAs

    Type
    Collection
    ...that are upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...
  14. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ... consists of 5 individually packaged plasmids and 3 individually packaged strains, which are shipped as...Protocols & Resources Contents of Kit Original Publication Oligomerized pool engineering (OPEN): an 'open-source... in the Materials and Methods of your future publications. For your Materials and Methods section: "The...The plasmid kit used in this publication was a gift from Keith Joung (Addgene kit # 1000000013)" For your...
  15. CRISPR Plasmids - C. elegans

    Type
    Collection
    ...species = S. pyogenes (PAM = NGG) 47549 pDD162 (Peft-3::Cas9 + Empty sgRNA) R07E5.16 U6 yes, cut Goldstein...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...
  16. Addgene Packaged on Request: Scope of Service

    Type
    Collection
    ...Transfer plasmids with sequence from the 5′ to the 3′ ITR exceeding 4.7 kb Transfer plasmids with a cargo...without a guaranteed titer. Any titer expectations communicated by email will supersede the general guarantees...step of the QC process, viral genome sequence verification, may not yet have been completed at the time...longer turnaround time. Any timing expectations communicated by email will supersede the general estimated...
  17. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...). DeChenne-Peters et al. PLoS One. 2023 Mar 9;18(3):e0282170. PMID: 36893201 (Link opens in a new window...dehydrogenase (MDH). The MCC is a national group of educational leaders providing research opportunities to their...other members of the MCC community. They support educators interested in integrating MDH-related research...professional development, membership to a local hub of educators teaching MDH CUREs, and opportunities to mentor...of action, regulation and post-translational modifications, and metabolic pathways and protein interactions...His-tags are cloned at the C-terminus of MDH and, if indicated on the plasmid map, a TEV cleavage site is present...access for biochemistry research in undergraduate education: The malate dehydrogenase CURE community. J Biol...
  18. Mammalian RNAi Tools

    Type
    Collection
    ...conditional systems for RNA interference . Nature Methods, 3 (9), 682–688. PubMed (Link opens in a new window) ...search our full site . ID Plasmid Vector Type PI Publication Additional Resources Addgene Resources pLKO.1...
  19. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Bacteria SpeI + HindIII none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. ... Puro Abbosh pCFD3-MS2tail-Scaffold 78906 Fly dU6:3 none S. pyogenes Virmilion Perrimon pHDE-35S-Cas9-...polycistronic lentiviruses. Can express Cas9 with up to 3 gRNAs. Frew pSQT1313 Mammalian Single plasmid for ...expression of two gRNAs from Drosophila U6:1 and U6:3 promoters. Bullock pCFD5 Drosophila Utilizes endogenous...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...
  20. AAV for Neuronal Tracing

    Type
    Collection
    ...is able to replicate in the starter cell using the G-protein, which is supplied in trans . (3) Nascent ...which is not required for the transcription or replication of the genome within infected cells, but is required... cells that lack the G protein, the virus can replicate but the newly formed viruses are unable to infect...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...
Showing: 21 - 40 of 58 results