We narrowed to 41 results for: his
-
TypeCollection... Available modifications include histone acetylation by p300, histone demethylation by LSD1, cytosine ...
-
TALEN Plasmids and Kits
TypeCollection... was recently shown that TALE fusions with the histone demethylase LSD1 (Lysine specific demethylase) ...with the FLASH method can decrease the amount of Histone H3 lysine 4 (H3K4) di-methylation at the target... -
Ginkgo Bioworks COVID-19 Collection
TypeCollection...e.g. bacterial, yeast, or mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-... -
All Antibodies
TypeCollection...species. We currently assess western blot, immunohistochemistry, and immunocytochemistry. Addgene will continue... -
Botman-Teusink Yeast FP Collection
TypeCollection...Lee et al., 2013), and are available with URA3, SpHIS5 and KANMX markers. The FP together with the protothropic... -
CRISPR Plasmids and Resources
TypeCollection...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial... -
Antibody Production
TypeCollection...is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are fixed, permeabilized... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...and OZ548 OPEN OPEN gAGCTCCGTCtcgctgGCGGCCGAAg histamine receptor H3 (hrh3) OZ549 and OZ550 OPEN OPEN gCGCCACGGAcaataaaGAGGACTGCa... -
AAVED
TypeCollection...the lab (e.g., controls to perform, recommended histology conditions, minimum/maximum incubation time after... -
Microbiology Resources
TypeCollection...Prions Plasmids for Protozoa Species Entamoeba histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii... -
p53 Pathway
TypeCollection...TP53 dependent G2 arrest mediator candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...Recombinant Adeno-Associated Virus Vector Expressing Retinoschisin. Hum Gene Ther Clin Dev . Sep;26(3):165-76. ... -
Lentivirus Plasmids
TypeCollection...plasmid 14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-pLKO-puro 3rd inducible expression of... -
CRISPR Guide
TypeCollection... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers...153 (4), 910–918. PMID: 23643243 Zhang, Y., & Marchisio, M. A. (2020). Type II anti-CRISPR proteins as... -
Neurodegeneration Research Collection
TypeCollection...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGGCCAAAGAAAAGGACGcgataagaaagtttgtTGTGGCTCAACTGCAGAA hist2h3ca1 TAL3284 & TAL3285 TCTGTTTGAGGACACCAAcctgtgcgccatccacgCCAAGAGGGTCACCATCA... -
Optogenetics AAV Preps
TypeCollection...ChrimsonR (soma-targeted) GCaMP8s Cre dependent 9 Histed 183519 pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE... -
Tetracycline Inducible Expression
TypeCollection...state of each cell in a population. Proliferation history is monitored by the dilution of a dox-inducible... -
Luciferase Plasmid Collection
TypeCollection...of C-terminal luciferase fusions (NanoLuc-3xFLAG-10xHis) using Gateway cloning for expression in plants... -
Validated gRNA Sequences
TypeCollection...GGGACCTGACCGGCCGCAGG 42245 cut S. pyogenes 23360964 Joung his3 S. cerevisiae ATTGCGATCTCTTTAAAGGG 64333 cut S. ...