We narrowed to 36 results for: his
-
TypeCollection...e.g. bacterial, yeast, or mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-...
-
All Antibodies
TypeCollection...species. We currently assess western blot, immunohistochemistry, and immunocytochemistry. Addgene will continue... -
Botman-Teusink Yeast FP Collection
TypeCollection...Lee et al., 2013), and are available with URA3, SpHIS5 and KANMX markers. The FP together with the protothropic... -
CRISPR Plasmids and Resources
TypeCollection...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial... -
Antibody Production
TypeCollection...is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are fixed, permeabilized... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection...and OZ548 OPEN OPEN gAGCTCCGTCtcgctgGCGGCCGAAg histamine receptor H3 (hrh3) OZ549 and OZ550 OPEN OPEN gCGCCACGGAcaataaaGAGGACTGCa... -
Microbiology Resources
TypeCollection...Prions Plasmids for Protozoa Species Entamoeba histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii... -
p53 Pathway
TypeCollection...TP53 dependent G2 arrest mediator candidate Scotin Shisa family member 5 Sestrins SESN1 SESN2 SESN3 Sestrins... -
University of Florida Serotype Testing Panel for the Eye and Brain
TypeCollection...Recombinant Adeno-Associated Virus Vector Expressing Retinoschisin. Hum Gene Ther Clin Dev . Sep;26(3):165-76. ... -
Lentivirus Plasmids
TypeCollection...plasmid 14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-pLKO-puro 3rd inducible expression of... -
CRISPR Guide
TypeCollection... cytosines in a gene’s promoter or by inducing histone acetylation or demethylation. The most common modifiers...153 (4), 910–918. PMID: 23643243 Zhang, Y., & Marchisio, M. A. (2020). Type II anti-CRISPR proteins as... -
Neurodegeneration Research Collection
TypeCollection...95%) of ALS are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases... -
Optogenetics AAV Preps
TypeCollection...ChrimsonR (soma-targeted) GCaMP8s Cre dependent 9 Mark Histed 183519 pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE... -
Tetracycline Inducible Expression
TypeCollection...state of each cell in a population. Proliferation history is monitored by the dilution of a dox-inducible... -
Validated gRNA Sequences
TypeCollection...GGGACCTGACCGGCCGCAGG 42245 cut S. pyogenes 23360964 Joung his3 S. cerevisiae ATTGCGATCTCTTTAAAGGG 64333 cut S. ... -
Brain Initiative Collection
TypeCollection...separated by cleavable peptide sequence P2A. Mark Histed 179459-AAV1 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE Double...