We narrowed to 114 results for: LAT;
-
TypeCollection...BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting H. .... sapiens GTAGGCGCGCCGCTCTCTAC 71830 methylation S. pyogenes 26969735 Zoldoš AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT...TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: ...
-
CRISPR Plasmids - Yeast
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid... -
AAV Molecular Tools
TypeCollection...Kim Tools for Cell Ablation These AAV encode tools that can be used for cell ablation. ID Name Expression...Transactivators Affinity Purification Neurophysiology Cell Ablation Genome Engineering Labeling Overexpression Tracers... toxin receptor fused to GFP for studying cell ablation. 2 Thomas Jessell , Eiman Azim 45580 pAAV-flex-taCasp3...designer pro-taCasp3 and TEVp for studying cell ablation. 1, 5 Nirao Shah , Jim Wells Genome Engineering... -
Arf GTPase Family
TypeCollection...Plasmids References The ARF (ADP-ribosylation factor) family of regulatory GTPases have long been characterized...ARF family plasmids. ARF family members include regulatory GTPases, GEFs, and GAPs. Plasmid..., 2016). Though best known for their roles as regulators of membrane traffic, they also play critical ... and mitochondria. The activity of GTPases is regulated both upstream (by GEFs, guanine nucleotide exchange... -
TALEN Plasmids and Kits
TypeCollection...TAL Effector Kit 2.0. Stephen Ekker Platinum Gate TALEN Kit Platinum TALENs assembled by Golden Gate. Validated... and showed robust cleavage activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors... the amount of Histone H3 lysine 4 (H3K4) di-methylation at the target locus ( Mendenhall et al., 2013...This epigenome editing was also shown to alter regulation of nearby gene expression. The vectors listed... -
CRISPR Plasmids - Tagging
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...101 post for more information about HDR/repair template design. How to use CRISPR to tag your gene of ... (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This vector serves...encodes both a guide RNA transcript and a repair template for an individual tagging event. The kit contains...plasmids in the following articles provide PCR templates for amplification of the tag (eg GFP, Flag, YFP... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR 71667 Mammalian U6 yes, methylation S. pyogenes...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...S. pyogenes Kamoun pUC119-gRNA 52255 Plant PCR template none S. pyogenes Sheen pRGEB31 51295 Plant BsaI...pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation S. pyogenes Puro Zoldos pBLO1811_Cas9_noNLS_human...multiplexed plant genome editing and transcriptional regulation Plant Three types of plasmids available for use... -
CRISPR Plasmids - Parasites
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ... these parasites. Moreover, CRISPR-dCas9 gene regulation has also been established for some of these parasites...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed... -
CRISPR Plasmids - C. elegans
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid... -
SARS-CoV-2 Pseudotyped Virus
TypeCollection... and a D614G change which is present in many circulating variants. The table below lists expression plasmids... Mutations Industry PI Due to export control regulations, MERS and SARS-CoV materials are available only...simultaneously measure the # of cells containing reactivated latent provirus and the overall strength of viral transcriptional...luciferase. Used in lentivirus-based SARS-CoV-2 related pseudovirus assay. David Nemazee 170575 pCMV-FLuc... -
CRISPR Plasmids - Prime Edit
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...binding site (PBS) and the desired edits on an RT template. During prime editing, the pegRNA directs the ...transcriptase. Engineering of the PE enzyme and related components have helped to improve the efficiency...the reverse transcriptase. Many PE enzymes and related tools are available: PE2 - introduction of five... -
Worm Expression Resources
TypeCollection...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...nematodes, including C. elegans and C. briggsae. Other related miniMos plasmids can be found on the Jorgensen ...genetics, genomics and biology of C. elegans and related nematodes. WormBook - A comprehensive, open-access...original, peer-reviewed chapters covering topics related to the biology of C. elegans and other nematodes... -
Fluorescent Proteins: FRET
TypeCollection... nm 4 ). Values obtained from FPbase.org FRET calculator (Link opens in a new window) *: Long Stokes shift...many factors, such as the organism or cell type, relative position and orientation of the fluorophores through...Collection or the Promega Plasmid Collection to find related tools for BRET assays. References Bajar, B. T.,...new window) External Resources FPbase.org FRET calculator (Link opens in a new window) Nikon MicroscopyU... -
Bacterial Expression Systems
TypeCollection...expressed alongside epitope tags, which can also later be used for protein detection in western blots, ...for a selection of mammalian and bacterial FRET-related vectors and standards. The Hoschschild Bacterial... fuse proteins of interest to transcriptional regulatory elements that will turn on gene expression upon...extensive selection of plasmids using tetracycline-regulated transcriptional activation or repression. The ... -
NETRF
TypeCollection...effective treatments for carcinoid, pancreatic, and related neuroendocrine cancers. The NETRF believes that...Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors...Tumors Qiao Zhou Harvard University Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors... -
CRISPR Plasmids - Activate Gene Expression
TypeCollection...CRISPR plasmids for activating or upregulating gene expression in various model organisms....Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ... to direct the dCas9-activator to promoter or regulatory regions of your gene of interest. If the plasmid... -
Cancer Research Plasmids and Resources
TypeCollection...normal cell signaling and physiology, and, when dysregulated, can enable cancer cell survival. Although cancers...states. Ras Ras is a GTPase that is essential for regulating the growth of the cell. p53 p53, the most frequently...Esposito Lab for use with the Gateway® Cloning Platform (Life Technologies™) to permit construction of... -
CRISPR Plasmids - RNA Targeting
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...the spread of infection throughout the entire population. Type VI enzymes that function in mammalian cells...mammalian systems, Cas13a does not exhibit the collateral RNA degradation seen in bacteria. Want more information... -
CRISPR Plasmids - Double-Strand Break (Cut)
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with 1. homology to the DNA flanking the DSB and...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed... -
CRISPR Plasmids - Zebrafish
TypeCollection...Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...