We narrowed to 89 results for: bli
-
TypeCollection...Marker PI Publication Return to top Bacteria ID Plasmid Gene/Insert Selectable Marker PI Publication Return...
-
Botman-Teusink Yeast FP Collection
TypeCollection...TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication FP Overexpression Plasmids for constitutive overexpression...marker. ID Plasmid Gene/Insert Selectable Marker Publication Additional Resources Addgene Kits MoClo-YTK Yeast... -
CRISPR Plasmids - C. elegans
TypeCollection...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a ...specific locus. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Institute for Cell Science has produced the first publicly available collection (Link opens in a new window...: 28814507 (Link opens in a new window) More publications from the Allen Institute for Cell Science (Link... -
AAV Packaged on Request
TypeCollection...often goes unshared, bridging the gap between published methods and real-world troubleshooting. Eligible...with troubleshooting and results that complement published data, capturing the insights that often go unshared... -
Zebrafish Plasmid Collection
TypeCollection... fish in the minnow family. It has long been established as a powerful vertebrate model organism for the...Shuo Lin Lab Re-purposed Ac/Ds transgenic system enabling CRISPR/dCas9-interference (CRISPRi) modulation... -
Fluorescent Proteins: FRET
TypeCollection...designing your experiment, be sure to refer to published reports and include appropriate controls to help...controls for many FRET pairs Michael Davidson Lab (Unpublished) FRET Indicators - Live and Fixed Cells Additional... -
CRISPR Guide
TypeCollection...Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an interesting...to check the library information and original publication to see if a library is suitable for your experiment...specified by the gRNA plus the genomic PAM sequence Publications (by topic) CRISPR basics Anders, C., Niewoehner.... D., Gross, C. A., & Rosenberg, O. S. (2019). Enabling genetic analysis of diverse bacteria with Mobile-CRISPRi... -
CRISPR Plasmids - Tagging
TypeCollection... supplemental materials from the Doyon Lab’s publication: Dalvai et al. Cell Rep. 2015 . Alternatively...Institute for Cell Science has produced the first publicly available collection of fluorescently tagged, ... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...sites, Flp with FRT sites, Dre with rox sites), enabling precise genetic manipulation without cross-reactivity...recombination events in a single experimental system, enabling multi-layered genetic control. Recombinase-mediated... -
CRISPR References and Information
TypeCollection...Addgene CRISPR blogs CRISPR tips, FAQs, and news published on the Addgene blog. CRISPR Pooled Libraries Addgene's...window) A collection of protocols, materials, and publications by members of the Division of Signaling and ... -
Deisseroth INTRSECT Collection
TypeCollection... INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting) is a synthetic molecular... mouse and rat lines. The Fenno Lab maintains a public folder (Link opens in a new window) of manuscripts... -
Luciferase Plasmid Collection
TypeCollection...Gaussia luciferase is secreted and more stable, enabling time course experiments, but is too dim for some...your experiment, check the plasmid's original publication or read our Luciferase blog post . Empty Backbones... -
The Pleiades Promoter Project
TypeCollection...window) was established to advance research and therapies for brain disorders by enabling region- and ... -
Caltech Systemic Capsids
TypeCollection...and the Caltech CLOVER Center’s repository of published capsid use (Link opens in a new window) . Viral...Information When using the Caltech serotypes in future publications, please acknowledge Viviana Gradinaru and cite... -
CRISPR History and Development for Genome Engineering
TypeCollection... PubMed lists more than 6,300 CRISPR-related publications, many of which detail work to improve the tool... providing tips from experts in the field, and enabling access to multiple plasmids used for various platform... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Capsids AAV Packaged on Request AAV Guide Plasmids Publications Enhancer AAV plasmids are plasmids which use...= Substantial non-specific labeling observed Publications Ben-Simon, Y., Hooper, M., Narayan, S., Daigle... -
Validated gRNA Sequences
TypeCollection...TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG 59724 cut S. pyogenes...be added to this table from any peer reviewed publication. To add validated gRNA sequences to our datatable... -
Brain Initiative Collection
TypeCollection...development and application of innovative tools enabling large-scale real-time interrogation and monitoring...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ... -
Antibody Guide
TypeCollection...short peptide linkers. Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody...specific to your antibody and assay may already be published. If it is not, you’ll need to validate the antibody...