We narrowed to 129 results for: SCR
-
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity, experimental considerations,...
-
Adenovirus Plasmids
TypeCollection...strains for generating adenovirus. ID Strain Description PI 16398 BJ5183 Strain for recombination between... plasmids that have inserts. ID Plasmid Type Description PI 16400 pAdEasy-1 Adenoviral For recombining... be assembled in a one-tube reaction. ID Kit Description PI 1000000176 AdenoBuilder toolkit Plasmids contain... -
Distribution to Industry
TypeCollection...Plasmid Gene/Insert PI Kits Kit name Type PI Description High Complexity Golden Gate Assembly Standards...Pooled Libraries Pooled Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten...exon 5–8. Phagemid Synuclein VHH Immune Library Screening Messer and MJFF Created for research in Parkinson's... -
Validated gRNA Sequences
TypeCollection...the particular conditions of the experiment as described in the associated article (listed below by PubMed...within promoters. When possible, the categories described on Addgene's CRISPR Plasmids and Resources page...GCGGCAGCTCCTAGCTCAGC 61515 nick S. pyogenes 25569111 Hanna mitf S. scrofa CTTTCGGATATAATCCACGG 69801 cut S. pyogenes 26293209...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285 interfere... -
Brain Armamentarium
TypeCollection...below. Plasmids ID Plasmid Description PI Viral Preps ID Viral Prep Description PI (Cargo) PI (Capsid) 214869...labeling in neurons. Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting Viviana Gradinaru... -
Genetic Code Expansion
TypeCollection...M. barkeri , or E.coli and can be mutated and screened through directed evolution to charge the tRNA ...research, you can get advice from GCE experts by subscribing to the GCE bulletin board (GCEbb) listserve and...non-standard amino acid incorporation. ID Strain Description PI 48998 C321.ΔA all TAG sites changes to UAG... -
Fluorescent Protein Guide: Activity Regulation
TypeCollection...activity. Early tools allow scientists to regulate transcription, and additional tools are being developed to...Principal Investigator Plasmids GFP GFP-dependent transcription factors Connie Cepko See Plasmids Dronpa Optical... -
CRISPR Plasmids - dCas9-FokI
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
Synthetic Biology - Cloning and Genomic Tools
TypeCollection...available from this depositor's lab. Plasmid Description Gene/Insert Vector Type PI Publication Back to... plasmids from this depositor's lab. Plasmid Description Vector Type Selectable Marker PI Publication ... -
Brain Initiative Collection
TypeCollection... with Addgene materials. Plasmids ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use...Learn more about our viral service ID Viral Prep Description PI 65417-AAV8 pAAV-hSyn-dF-HA-KORD-IRES-mCitrine...labeling in neurons. Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2... -
Joung Lab CRISPR-Cas/RNA-Guided Nuclease (RGN) Plasmids
TypeCollection...cleaves the target DNA. The Joung lab recently described gRNA and Cas9 expression vectors and validated...Engineering newsgroup here . Links to additional pages describing Joung Lab CRISPR-Cas/RGN reagents: Cpf1 expression... -
CRISPR Plasmids for Genomic Visualization
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids - Parasites
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
CRISPR Plasmids - CRISPR Transposases (CAST)
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
Chemogenetics Plasmids
TypeCollection...inhibit the target neuron. For more detailed descriptions of chemogenetic receptors, ligands, and how ...preparations of many chemogenetics plasmids. ID Plasmid Description Gene/Insert Vector Type Promoter Tags PI Do you... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...Genome Editing Cut Base Edit Nick Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs... -
Resolute Plasmid Collection
TypeCollection...pooled libraries are useful tools for genetic screening experiments. These libraries target the solute...solute carrier family of proteins. Library ID PI Description Human SLC Activation Library 132561 Superti-Furga... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...10.1038/nprot.2009.98. Epub 2009 Sep 17. PubMed . Description Use of the OPEN method requires OPEN pools (available...using the bacterial two-hybrid system originally described by Hochschild and colleagues ( Dove et al., Nature... -
Serotype Testing AAV
TypeCollection...Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in various serotypes suitable... Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV in various serotypes suitable... -
Addgene Packaged on Request: Scope of Service
TypeCollection...been completed at the time of shipment. If any discrepancies are identified during this analysis, you will... that we will not meet the turnaround time we described here or by email, Addgene will contact you to ...