We narrowed to 127 results for: Arc
-
TypeCollection...and 63AA, respectfully). This next generation architecture has been shown to increase mutation induction...cells, (iv) an improved, truncated TALE backbone architecture as established by Miller et al. (PMID: 21179091...
-
Plan Your Experiment
TypeCollection...Started CRISPR is a powerful system that enables researchers to manipulate the genome like never before. This...framework to get you started using CRISPR in your research. Although we will use the example of CRISPR/Cas9... -
Luciferase Plasmid Collection
TypeCollection...luciferase from a cell-free mammalian cell lysate Marcel Bruchez 108542 pLenti-EF1a-Luciferase-IRES-Blast-WPRE...need a luciferase reporter for? Browse or use the search box to find a construct that contains your regulatory... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Opitz-Araya X, Roth JR, Allen S, Ayala A, Bakken TE, Barcelli T, Barta S, Bendrick J, Bertagnolli D, Bowlus ...Departee M, Donadio N, Dotson N, Egdorf T, Gabitto M, Garcia J, Gary A, Gasperini M, Goldy J, Gore BB, Graybuck... -
Validated gRNA Sequences
TypeCollection...GATCCACAAGTTACAATTGG 46170 cut S. pyogenes 23817069 Calarco Kras, p53, and Lkb1 M. musculus multiple, see article...GAATTTTCTGAAATTAAAGA 46169 cut S. pyogenes 23817069 Calarco unc-22 C. elegans GAACCCGTTGCCGAATACAC 58202 cut... -
Synthetic Biology - Browse Plasmids
TypeCollection...email [email protected] . Synthetic Biology Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Algal
TypeCollection...biology plasmids for use in algae. Algal Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Bacterial
TypeCollection...plasmids for use in bacteria. Bacterial Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Fungal
TypeCollection...biology plasmids for use in fungus. Fungal Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Mammalian
TypeCollection...for use in mammalian systems. Mammalian Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Plant
TypeCollection...biology plasmids for use in plants. Plant Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Worm
TypeCollection...biology plasmids for use in C. elegans. Worm Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Yeast
TypeCollection...biology plasmids for use in yeast. Yeast Plasmids Search the table by keyword or sort by the table headings... -
Tags and Other Markers
TypeCollection...and Other Markers Antibody Collection Browse or search the table below to find antibodies currently available... -
Synthetic Biology - Strains
TypeCollection...related bacterial strains. SynBio Bacterial Strains Search the table by keyword or sort by the table headings... -
Cell Migration Consortium Plasmids
TypeCollection...have deposited plasmids useful for cell migration research at Addgene. CMC investigators who have deposited... -
Synthetic Biology - Sensing and Signaling
TypeCollection...environmental sensing. Sensing and Signaling Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Metabolism
TypeCollection...Pathways Efflux Pumps Flux Control Metabolism Plasmids Search the table by keyword or sort by the table headings... -
Synthetic Biology - Networks and Gene Regulation
TypeCollection...logic gates Networks and Gene Regulation Plasmids Search the table by keyword or sort by the table headings... -
CRISPR Plasmids - dCas9-FokI
TypeCollection... off-target effects of CRISPR. Browse, sort, or search the tables below for CRISPR-FokI plasmids. Plasmids...