We narrowed to 19 results for: Ski
-
TypeCollection...Collections Brzezinski Lab CRISPR Collection Brzezinski Lab CRISPR Collection The Brzezinski lab investigates...Cloning Protocol (PDF, 237 KB) Dual guide cloning: Brzezinski Lab Dual Guide Protocol (PDF, 990 KB) Plasmid...R., Abraham, J., Hensley, A., Jones, K. L., & Brzezinski, J. A. (2021). Initiation of Otx2 expression ...Goodson, N. B., Kaufman, M. A., Park, K. U., & Brzezinski, J. A. (2020). Simultaneous deletion of Prdm1...
-
Biosensor AAV Preps
TypeCollection...dependent 1 Podgorski 135421 pAAV-syn-FLEX-axon-jYCaMP1s Syn jYCaMP1s none Cre dependent 1 Podgorski 135424...pAAV-syn-jYCaMP1s Syn jYCaMP1s none Constitutive 1 Podgorski Calcium Sensor: CaMPARI 100831 pENN.AAV.CAG.Flex.CaMPARI.WPRE.SV40...PDGFR.codonopt Syn iGluSnFr3 v857 none Cre dependent 1 Podgorski 175181 pAAV.hSyn.FLEX.iGluSnFR3.v857.GPI.codonopt...GPI.codonopt Syn iGluSnFr3 v857 none Cre dependent 1 Podgorski 178329 pAAV.hSyn.iGluSnFR3.v857.PDGFR Syn iGluSnFr3...iGluSnFr3 v857 none Constitutive 1 Podgorski 196219 pAAV.CAG.FLEX.iGluSnFR3.v857.PDGFR CAG iGluSnFr3 v857...v857 none Cre dependent 2 Podgorski 234437 pAAV-syn-iGluSnFR4s-NGR-WPRE Syn iGluSnFr4s none Constitutive... -
Rett Syndrome
TypeCollection...30 months, is regression of previously acquired skills, notably loss of acquired purposeful hand movements...of speech. In contrast to the sustained loss of skills in neurodegenerative conditions, the regressive...developmental stabilization or even limited recovery of skills occurs. Diagnosis of Rett syndrome is currently...regression with a loss of spoken language and hand skills, development of repetitive hand stereotypies, and... -
Plasmids for Stem Cell Research
TypeCollection...activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human Sox2, Nanog... vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells. Stem...Stem Cell. 2012 Apr 6;10(4):465-72. Schöler Adult Skin Fibroblasts Cholinergic Neurons Lentiviral Human...Cell Stem Cell. 2015 Nov 5;17(5):543-56. Buganim Skin Fibroblasts Motor Neurons Lentiviral Human Direct... -
Neurodegeneration Plasmid Collection
TypeCollection...30 Frederic Mushinski 8418 pLTR PKC gamma PRKCG Spinocerebellar ataxia 29 Frederic Mushinski 8661 p4455...'s Gabriele Kaminski Schierle 108866 pT7-7 aSyn C141 SNCA T7 Parkinson's Gabriele Kaminski Schierle 108867...Gabriele Kaminski Schierle 108868 pLJM1 EGFP-Tau MAPT GFP CMV Parkinson's, FTD Gabriele Kaminski Schierle... Nicholas Tolwinski 160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1...Jonathan Ploski 233043 pLenti-CMV-eGFP-hTau P301L-WPRE MAPT GFP CMV Parkinson's, FTD Jonathan Ploski 233044...ABeta-attR5 APP Cleavage signal Alzheimer's Nicholas Tolwinski 160541 pGS_101 APOE Kar2 GAL1 Alzheimer's Susan...AP- WPRE MAPT GFP CMV Parkinson's, FTD Jonathan Ploski 233273 pAAV-CMV-GFP-pA U6 shRNA (Rat Nurr1 #1) ... -
Brain Initiative Collection
TypeCollection...production or direct transfection, slow variant Kaspar Podgorski 135421-AAV1 pAAV-syn-FLEX-axon-jYCaMP1s Axon-targeted...production or direct transfection, slow variant Kaspar Podgorski 135424-AAV1 pAAV-syn-jYCaMP1s Yellow protein calcium...production or direct transfection, slow variant Kaspar Podgorski 135630-AAV1 pAAV-S5E2-dTom-nlsdTom AAV vector ... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection.... pyogenes Matlashewski pSPneoHHgRNAH 63557 Other/Leishmania none S. pyogenes Matlashewski pLH-spsgRNA2...Mammalian U6x2 yes, nick S. pyogenes Puro Jackson pBluescriptSKII+ U6-sgRNA(F+E) empty 74707 Mammalian hU6 none... -
CRISPR Guide
TypeCollection... 556 (7699), 57–63. PMID: 29512652 Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & ... C. P., Bonetti, C., Vidigal, J. A., Han, Y., Ogrodowski, P., Crippa, A., Rekhtman, N., De Stanchina, ..., M. T. N., Ioannidi, E. I., Schmitt-Ulms, C., Krajeski, R. N., Lim, J., Villiger, L., Zhou, W., Jiang... -
Fluorescent Protein Guide: Biosensors
TypeCollection...May 25. pii: 10.1038/s41592-020-0835-7. Kaspar Podgorski Calcium HaloCaMP1 chemigenetic calcium indicator...transmission. Nat Methods. 2023 May 4. Kaspar Podgorski Glutamate FRET sensor to monitor glutamate transport... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection... S. A., Mueller, I. A., Yang, R., Horwitz, R., Rafelski, S. M., & Gunawardane, R. N. (2017). Systematic... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Library described in: Barber, K. W., Muir, P., Szeligowski, R. V., Rogulina, S., Gerstein, M., Sampson, ... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection... modify the genome or control gene expression or skip ahead to browse highlighted plasmids expressing ... -
Deisseroth INTRSECT Collection
TypeCollection...Deisseroth K, Zhao F, Luo MH, Gong L, He M, Zhou P, Paninski L, Li B. 2017. The central amygdala controls learning... -
Immunology Research Plasmids and Resources
TypeCollection...pathogen. It includes physical barriers such as the skin and mucosa, antimicrobial peptides and proteins ...chemokine (C-C motif) ligand 27 ALP, CTACK, CTAK, ESKINE, ILC, PESKY, SCYA27 CCL28 chemokine (C-C motif)... -
CRISPR History and Development for Genome Engineering
TypeCollection...Bacteriol . 169(12):5429-33. PMID: 3316184 Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier ... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...Hooper, M., Omstead, V., Vargas, S., Lerma, M. N., Taskin, N., Weed, N., Laird, W. D., Bishaw, Y. M., Bendrick... -
Tetracycline Inducible Expression
TypeCollection...components of tet systems and how to use them, or skip ahead to view highlighted Tet plasmids . Figure ... -
Plan Your Experiment
TypeCollection... the cell type. Before proceeding, we recommend asking labmates/colleagues, searching the literature, ... -
Validated gRNA Sequences
TypeCollection...see article 69537 activate S. pyogenes 26352799 Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut...