Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 15 results for: c myc del 2

Showing: 1 - 15 of 15 results

  1. Plasmids for Stem Cell Research

    Type
    Collection
    ...2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2 as ...Aug 1;13(2):246-54. Dowdy Adenovirus Mouse Non-integrating expression of mouse Sox2, Oct4, c-Myc, and Klf4...Reprogramming factors for delivering synthetic mRNAs encoding human Klf4, Oct4, Sox2, c-Myc, and Lin28A to somatic...state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible...for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced Under... vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming...

  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early ...pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling...-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc ...dependent on cell cycle) Centrin-2 EGFP Erich Nigg 41151 pEGFP Cep170 C-term Centrioles (dependent on cell...pCMV-mGold-Tubulin-C-18 Microtubules alpha-tubulin mGold Francois St-Pierre 158009 pCMV-mGold-Actin-C-18 Actin ...Voeltz 73209 pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel...Bruchez 73209 pcDNA3.1-kappa-myc-dL5-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel...

  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161586 pPuro3.1(+)_Strep-Lrrk2(delKinase)-Myc LRRK2 Myc, Strep...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...

  4. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...display vector with a C-terminal Myc tag pPMW-attB - pUASp plasmid with N-terminal Myc tag and attB for Drosophila...N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast...vector for C-terminal 3x HA tag fusion with your gene of interest in plants Myc Epitope tag pKMyc - N-terminal...transgenesis His Epitope tag pEZYmyc-His - C-terminal Myc-His tag for mammalian expression...backbone, mammalian expression pENTR4-myc-nuc - pEntry vector that adds a C-terminal nuclear localization signal...MCS-BioID2-HA or myc-BioID2-MCS - To fuse your protein of interest to the N-terminus or C-terminus of BioID2... Backbones Flag Epitope tag c-Flag pcDNA3 or FLAG-HA-pcDNA3.1 - C-terminal Flag or N-terminal FLAG-HA...

  5. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA. Screen each clone...genomic deletion. Run sample in thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2... and H 2 O up to 20 μl. Use the primers designed in step 2 above. Conduct PCR for “non-deletion band” ...

  6. Luciferase Plasmid Collection

    Type
    Collection
    ...five transcriptional reporters for NF-kb, TGF-b, c-Myc, p53, and MAPK/JNK plus a constitutive control. ...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Luminopsins : Luciferase-opsin...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal Fifrefly luciferase fragment for split-luciferase...transfection Feng Zhang 21471 pLenti PGK V5-LUC Neo (w623-2) Firefly PGK Lentiviral expression of firefly luciferase...

  7. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637 Broad GPP Humagne Set C and Humagne...Humagne Set D 172650 (Set C) 172651 (Set D) Knockout Human Doench and Root 2nd 2 40,710 Inzolia Human CRISPR...3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pneumoniae M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus...GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 76,441...

  8. Tetracycline Inducible Expression

    Type
    Collection
    ...opens in a new window) Krueger, C., Pfleiderer, K., Hillen, W., & Berens, C. (2004). Tetracycline derivatives...inducible expression of mouse Oct4, Sox2, Klf4, and Myc for iPS cell generation Rudolf Jaenisch 51543 FUW-tetO-hOKMS...inducible expression of human Oct4, Sox2, Klf4, and Myc for iPS cell generation Tarjei Mikkelsen 172115 PB-TO-hNGN2...vector to express Tet-On 3G transactivator under the c-Fos promoter Tet-On 3G rtTA Bong-Kiun Kaang 20342 ...hSyn promoter rtTA3 Wei Xu 26803 pEnt L1L3 EF1a-tTA-2 Gateway entry vector to express tTA from EF1α promoter... N., Schambach, A., Galla, M., Maetzig, T., Baum, C., Loew, R., & Schiedlmeier, B. (2011). Retroviral ...expression and improved dynamic range . Hum Gene Ther, 22 (2), 166–176. https://doi.org/10.1089/hum.2010.099 (Link...

  9. Validated gRNA Sequences

    Type
    Collection
    ... Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...& Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans TGAAGAAAGTTATACTCGA...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus...

  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...EGFP Del Bene pUAS:Cas9T2ACre;U6:sgRNA1;U6:sgRNA2 74010 Zebrafish U6 yes, cut S. pyogenes Cre Del Bene...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...Cas enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...pyogenes Zhang PX854 62886 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang pGuide 64711 Mammalian ...pyogenes Zhang PX852 62884 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang PX855 62887 Mammalian BbsI...

  11. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...production, including codon optimization, deletion of the C-terminal 18-21 amino acids and a D614G change...pseudotyping with SARS-CoV-2 spike protein. Collections... Collections COVID-19 - Viral Pseudotyping SARS-CoV-2 Pseudotyped Virus...Virus Mechanisms of SARS-CoV-2 infection remain poorly understood but are critical for developing therapeutic...spread. As a Biosafety Level 3 (BSL-3) agent, SARS-CoV-2 requires specialized facilities for the study of the...replication-defective virus particles with the SARS-CoV-2 spike (S) glycoprotein on the envelope surface. Pseudotyped... express ACE2, the cellular receptor for SARS-CoV-2, in a single round of viral entry and infection. This...

  12. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...

  13. mTOR Pathway

    Type
    Collection
    ...PKC beta PKC delta PKC epsilon PKC gamma PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also... Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017. PubMed PMID: 22500797 . Rapamycin: one drug, many...known as RPS6KB1; Ribosomal protein S6 kinase B1 TSC1/2 TSC1 TSC2 Tuberous sclerosis VHL Von Hippel-Lindau...Rictor RPTOR independent companion of MTOR, complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return...Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53 PDK1 Pyruvate dehydrogenase...

  14. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...plasmid Bullock and Port 49409 pCFD2-dU6:2gRNA dU6:2 BbsI Injection or in vitro transcription Virmilion...frequently causes insertions or deletions (indels) in the DNA. Indels often lead to frameshifts, creating...is capable of installing targeted insertions, deletions, and all possible base-to-base conversions using...plasmids. ID gRNA Plasmid Promoter Cloning Enzyme(s) Delivery Resistance Co-expressed Cas9 Depositing lab Cas9...Port 49330 pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu 45946 pU6-BbsI-chiRNA dU6...

  15. CRISPR References and Information

    Type
    Collection
    ...coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish, mouse, rat, and ...Link opens in a new window) An encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme...library amplification 1 vector system: lentiCRISPR v2 2 vector system: lentiCas9-Blast and lentiGuide-Puro...off-target binding. Currently supports over 20 model and non-model invertebrate species. Developed by the Kate... of CRISPR plasmid kits. CRISPR Software Sanger Indel Analysis ICE (Inference of CRISPR Edits) This open...al. (2019) (Link opens in a new window) . MAGeCK Model-based Analysis of Genome-wide CRISPR/Cas9 Knockout...a new window) A webtool that uses deep learning models for SpCas9 gRNA design and efficiency prediction...
Showing: 1 - 15 of 15 results