Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 4 of 4 results

  1. Validated gRNA Sequences

    Type
    Collection
    ...70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S. pyogenes 26541286...

  2. Antibody Plasmid Collection

    Type
    Collection
    ...of other proteins, visualize a protein under a microscope, or detect when the protein is present in a sample...

  3. Antibody Guide

    Type
    Collection
    ..., and wash. Preserve sample and image using a microscope. Special considerations Many of the steps in ...

  4. CRISPR Guide

    Type
    Collection
    ... PMID: 28841410 Increasing the genome-targeting scope and precision of base editing with engineered Cas9...
Showing: 1 - 4 of 4 results