...expand the gene-editing applications and targeting scope of ABEs David Liu’s lab set out to evolve ABEs with...However, the increased editing speed and targeting scope of ABE8e comes with a price: ABE8e showed increased...

... Protocols Using a Light Microscope Using a Light Microscope Intro to the Lab...dish. Microscopes come in a huge range of shapes and sizes - from phone-sized, foldable microscopes that...encounter: the compound light microscope. As the name suggests, light microscopes take advantage of the physical...light microscope with the main components labeled: Figure 1: Diagram of a compound light microscope with...Equipment Light Microscope Prepared Slides (or other sample that can fit on a microscope stage) Reagents...you are using the microscope you may wish to record your observations. Some microscopes have digital cameras...take care of your microscope. Bumps, scratches, and dust can easily impair microscope performance. Be sure...

... one needs to capture a diverse range of CTCs to cope with the variation in cancer, not just the CTCs ...

...and implementation of new strategies designed to cope with current increases. These two rulings along ...

...nearly every participant. Robert Bramson, author “Coping with Difficult People,” identified seven types ...with each of these personality types is beyond the scope of this article, there are a few principles that...

...to admit that paper-based record keeping barely copes with the growing amounts of digital data generated...

...couldn’t fight effectively. I had to learn how to cope with a different climate and culture, and also needed...

...70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S. pyogenes 26541286...

...of other proteins, visualize a protein under a microscope, or detect when the protein is present in a sample...

..., and wash. Preserve sample and image using a microscope. Special considerations Many of the steps in ...

...structural specificity to the viewer. Finally, modern microscope designs may further exploit the unique characteristics...non-converging or diverging) excitation light exits the microscope objective evenly illuminating the entire (wide...Therefore these are sometimes call Epi-fluorescence microscopes. (See left image above for an example image)....by pixel is slow; therefore, certain confocal microscopes use parallelization to enhance performance. In...and a reduction in signal intensity. 2-Photon microscopes restrict excitation (and bleaching) to a single... scanning as is done in confocal or 2-photon microscopes. Total Internal Reflection Microscopy (TIRF) ...the diffraction (resolution) limit of a light microscope. Due to the wave nature of light, an infinitely...

...PrakashLab #foldscope) had taken out a few foldscopes and held an improv workshop. These paper microscopes work...paper-based, affordable, and portable microscope called the ‘foldscope’ (Dr. Prakash, Stanford University...work as conventional microscopes and give a similar optical quality (magnification of 140X and 2 micron...worked many hours in a dark room with a confocal microscope, yet I was once again fascinated by the world...when looking down a paper thin and very portable microscope. Less fluorescence admittedly, but still so beautiful...listening to’ microbes But seeing microbes through a microscope is not the only way to visualize them. You can...

...beyond the scope of this post. Are your fluorescent proteins compatible with your microscope optics? To...imaged in distinct fluorescent channels on the microscope. With the proliferation of fluorescent proteins...and that can be imaged with the optics on the microscope(s) you intend to use. An accurate determination...you are interested in are compatible with your microscope optics, you will want to compare the excitation...protein with the filter sets or lasers on your microscope. Ideally, you would like to have substantial ..., so that the protein is well excited by your microscope and the fluorescence emission of the protein ...protein is efficiently collected by the microscope. To compare the match between a fluorescent protein and a...

...cleared rodent brain, the Ultramicroscope was developed using a stereomicroscope to capture large field-...techniques that make tissues transparent are enabling microscopes to visualize the cellular architecture of whole...foundation for all subsequent versions of LSFM microscopes (3,4). After this initial application, Stelzer... single-plane or selective-plane illumination microscope (SPIM). In order to improve axial resolution ...microscopy vs. confocal microscopy In confocal microscopes, optical sectioning of a specimen is based on...photomultipliers used to detect light in confocal microscopes are less efficient than the modern cameras used...sides and merge the images, such as in the Ultramicroscope.  In addition, adjusting the thickness of the...

...Since its early years, the light microscope has been a powerful tool in almost all disciplines. In biology...experiments. Projects such as the OpenFlexure Microscope (Collins, et. al., 2020), the miCube, SQUID (...open-source hardware. Projects such as the OpenFlexure microscope or open-source modular optical toolbox openUC2...increases accessibility. Through this approach, the Planktoscope, a portable device for studying plankton using... left panel shows the path of light through a microscope. Lower left panel shows an image of differentiating...Robotic microscopy for everyone: the OpenFlexure microscope," Biomed. Opt. Express 11, 2447-2460 (2020) Hongquan...

...track them. We have a number of microscopes, including an automated microscope but we need to develop the ...skills at the regular microscope, and the scripting skills at the automated microscope  to keep our worms...

...microscopy This technique uses a fluorescence microscope where the light source is mounted above (epi)...specimen and the excitation light passes through the microscope objective lens on its way toward the specimen...occurs only at a chosen focal volume and thus the microscope captures only fluorescence coming from this volume...particular stimulus. Using an epifluorescence microscope and GFP fusion proteins controlled by promoters...

...and get focused on the task at hand. Define the scope of the meeting: Are you meeting to design an entire...research direction you’d like to pursue? Undefined scope can lead to long meetings spent on details that ...achieve the purpose of the meeting (see “defining the scope” above) or if you can cut it down to thirty minutes...

... search scoped to plasmids shows filters for expression and vector type, while a search scoped to viral...given category, and serve as a shortcut to a search scoped to that category. Catalog ID suggestions provide...

...guidelines to authors and see whether your paper is in scope for the journal’s coverage. These guidelines also... manuscript Dos: Make sure your paper fits the scope of the journal you are sending it to. It’s wasting...manuscript decide on whether your manuscript fits the scope and the interest of the journal. Be sure to check...