Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 12 of 12 results
  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... import sequence and COX VIII signal peptide dL5 FAP; mCerulean3 Marcel Bruchez 44385 pLV-mitoGFP Mitochondria...2xG4S-mCer3 Nucleus NLS (from Mak16p protein) dL5 FAP; mCerulean3 Marcel Bruchez 73207 pcDNA3.1-KozATG-...KozATG-dL5-2XG4S-mCer3 Cytosol, nucleoplasm None dL5 FAP; mCerulean3 Marcel Bruchez 36206 pmTurquoise2-NES ...-TMst Cell surface (mammalian) PDGFR-derived dL5 FAP; mCerulean3 Marcel Bruchez 45944 pTDpelB-C_sfYFPTwinStrep... SKL tripeptide, peroxisome transport signal dL5 FAP; mCerulean3 Marcel Bruchez 85065 pmScarlet-I_peroxisome_C1...-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel Bruchez 73209 pcDNA3.1-kappa-myc-dL5...-2XG4S-mCer3-KDEL Endoplasmic Reticulum KDEL dL5 FAP; mCerulean3 Marcel Bruchez 85068 pCytERM_mScarlet-i_N1...
  2. Chemogenetics Plasmids

    Type
    Collection
    ... Roth 50478 pAAV-GFAP-hM3D(Gq)-mCherry hM3D (Gq) GFAP mCherry No Roth 50479 pAAV-GFAP-hM4D(Gi)-mCherry...50470 pAAV-GFAP-HA-hM3D(Gq)-IRES-mCitrine hM3D (Gq) GFAP IRES-mCitrine No Roth 50471 pAAV-GFAP-HA-hM4D(Gi...hM4D (Gi) GFAP IRES-mCitrine No Roth 50472 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine rM3D (Gs) GFAP IRES-mCitrine...hM3D (Gq) Syn No Richie 50478 pAAV-GFAP-hM3D(Gq)-mCherry hM3D (Gq) GFAP mCherry No Roth 83896 pAAV-hDlx-...KORD PSAM-Gly Promoter Synapsin CaMKIIa CD68 Dlx GFAP Other Reporter/Fusion mCherry IRES-mCitrine tdTomato...mCherry hM4D (Gi) GFAP mCherry No Roth 75033 pAAV CD68-hM4D(Gi)-mCherry hM4D (Gi) CD68 mCherry No Roth 50454...
  3. Cre-lox system

    Type
    Collection
    ...codon optimized Cre PGK AAV Aebischer 24704 GFAP-Cre Cre GFAP Mammalian Sofroniew 25997 LV-Cre pLKO.1 Cre...CMV Mammalian Hughes 40591 hGFAP-Cre mouse astrocyte expression of Cre hGFAP Mammalian Messing 45359 pNK-TGCK...PGK Retroviral Pandolfi 51263 hGFAP-Roxed-Cre Dre-dependent Roxed-Cre GFAP Mammalian Pelczar 51267 pCAG-Co-InCreN...EGFP-Cre fusion CMV AAV Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH Cre GFAP AAV Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...Bacterial Dunlop 135217 pDEST mfap4:icre-p2a-tomato iCre and tdTomato mfap4 Zebrafish Tobin 135618 pAAV-...
  4. Chemogenetics AAV Preps

    Type
    Collection
    ... NLS-dTomato none 1, 9, rg* Fishell GFAP promoter 50472 pAAV-GFAP-HA-rM3D(Gs)-IRES-mCitrine rM3D(Gs) -...50478 pAAV-GFAP-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 5 Roth 50479 pAAV-GFAP-hM4D(Gi...DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF E2 regulatory element Tag Fusion tags mCherry...
  5. Control AAV Preps

    Type
    Collection
    ...tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato...TurboRFP Constitutive 1, 5, 8 Wilson 105549 pAAV.GFAP.eGFP.WPRE.hGH GFAP EGFP Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG...serotypes. Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other Fluorophore/Tag ...
  6. The Pleiades Promoter Project

    Type
    Collection
    ... EGFP/NLS Ple88 GFAP pEMS1375 EGFP/NLS Ple88 GFAP pEMS1559 intron-lacZ/NLS Ple89 GFAP pEMS1376 EGFP/NLS...NLS Ple90 GFAP pEMS1121 EGFP/cre/NLS Ple90 GFAP pEMS1377 EGFP/NLS Ple92 GPR88 pEMS1160 EGFP/NLS Ple93 ...
  7. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...Laforin Human Mouse IgG2a 114536 Anti-GFAP R416WT [N206B/9R] GFAP R416WT Human Mouse IgG2a 114538 Anti-...] Frataxin Human Mouse IgG2a 177512 Anti-GFAP [N206A/8R] GFAP Human Mouse IgG2a 177513 Anti-LRP4 (extracellular...-2b] RGS14 Rat Mouse IgG2b 199410 Anti-GFAP [N206A/8R-2b] GFAP Human Mouse IgG2b 199412 Anti-Cav1.2 Ca2...Neurexin-1-Beta Human Mouse IgG1 206703 Anti-GFAP [N206A/8R-1] GFAP Human Mouse IgG1 206705 Anti-Cav1.2 Ca2...Neurexin-1-Beta Human Mouse 199426 GFAP scFv [N206A/8] N206A/8 scFv GFAP Human Mouse 199428 MAP3K12 scFv ...
  8. Biosensor AAV Preps

    Type
    Collection
    ...Constitutive 1, 5, 9 Looger 98930 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 GFAP iGluSnFr none Constitutive 1, 5,...none Cre dependent 1 Looger 106192 pAAV.GFAP.SF-iGluSnFR.A184S GFAP SF-iGluSnFR.A184S none Constitutive... Sensors GRAB_5-HT Promoter CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory element Activity...
  9. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Douglas Kim AV-1-PV2914 98930-AAV1 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Loren Looger AV-1-PV3080 100840-AAV1...Douglas Kim AV-5-PV2914 98930-AAV5 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Loren Looger AV-5-PV3107 52924-AAV5...Douglas Kim AV-9-PV2914 98930-AAV9 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Loren Looger AV-9-PV3081 100836-AAV9... Philip Haydon AV-5-PV2407 105549-AAV5 pAAV.GFAP.eGFP.WPRE.hGH James M. Wilson AV-5-PV3106 44332-AAV5 ...James M. Wilson AV-5-PV2408 105550-AAV5 pAAV.GFAP.Cre.WPRE.hGH James M. Wilson AV-6-PV1090 105537-AAV6...
  10. Recombinases AAV Preps

    Type
    Collection
    ...-CreintG EF1a none 1 Cepko GFAP Promoter 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson rTH Promoter...
  11. Caltech Systemic Capsids

    Type
    Collection
    ...Cre-EGFP expression Cre Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP Cre-expression Cre Wilson 140135 pAAV-EF1a-iCreV...
  12. Validated gRNA Sequences

    Type
    Collection
    ...TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes 25619936 Sato gfap D. rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes...
Showing: 1 - 12 of 12 results