Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 32 results
  1. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian...Expression mPA-Emerald 487 509 - Monomer (A206K) mPA-Emerald-N1 - Mammalian Expression mPA-Emerald-C1 ...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...then scientists have engineered numerous GFP-variants and non-GFP proteins that result in a diverse set ...tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial expression Davidson Lab Plasmids...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...Mammalian Expression PA-GFP 504 517 14 Monomer (A206K) pPAGFP-N1 - Mammalian Expression pPAGFP-C1 - Mammalian ...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 ...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer ...89472 GFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 GFP Ken-Ichi Takemaru 89770 pLenti-EGFP-hChibby1...Filaments beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST...Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...38277 pMXs-puro GFP-p62 Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome...
  3. Retrovirus Plasmids

    Type
    Collection
    ...MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; Also expresses GFP; See plasmid 8452...resistance Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression...Plasmid for transgene expression; Also expresses GFP; Also see pMIG-w , a variant that has WRE, a post-transcriptional...gets integrated into the host's genome by the accompanying integrase protein. When scientists discuss retrovirus...of dsRed and the activation of your gene fused to eGFP expression Clevers 18760 MSCV IRES Luciferase MSCV...
  4. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...22222-AAV1 AAV-FLEX-Arch-GFP Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Ed Boyden AV...pAAV-CamKII-ArchT-GFP (PV2527) Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Ed Boyden AV-5-PV3447...pAAV-hsyn-Jaws-KGC-GFP-ER2 Ed Boyden AV-8-PV3638 65014-AAV8 pAAV-hsyn-Jaws-KGC-GFP-ER2 Ed Boyden AV-9-...22222-AAV9 AAV-FLEX-Arch-GFP Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Ed Boyden AV...29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170...59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger...AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3447 59171-AAV1 pAAV-Syn-ChrimsonR-tdT Ed...
  5. Cre-lox system

    Type
    Collection
    ...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler...13770 pCALNL-GFP Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV... CMV Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre...CAG Retroviral Gage 49056 AAV-GFP/Cre Cre-GFP fusion CMV AAV Gage 49111 pEMS1980 iCre with MCS for inserting...
  6. Control AAV Preps

    Type
    Collection
    ...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...dependent (constitutive) expression 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 8, 9, rg*, PHPeB, CAP-B10...*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894...PHP.eB Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory EGFP Constitutive 1, 9, PHP.eB Dimidschstein... 9 Wilson 105598 pAAV.GfaABC1D.PI.Lck-GFP.SV40 GfaABC1D Lck-GFP Constitutive 5 Khakh 105622 pAAV.CamKII...pAAV-hSyn-EGFP hSyn EGFP Constitutive 1, 2, 5, 8, 9, rg* Roth 50469 pAAV-CaMKIIa-EGFP CaMKIIa EGFP Constitutive...
  7. Bacterial Expression Systems

    Type
    Collection
    ...multi-cloning site compatible with standard cloning using many different restriction enzymes. pPro24-gfp contains...fluorophore-tagged MS2 (such as that found in pZS*12-MS2-GFP ) to track RNA localization of your gene of interest...lactose/IPTG inducible) Flag, His, Strep, mOCR, MBP, GFP, with and without SUMO or TEV cleavage sites to remove...contains GFP but all others are empty. pdCas9-bacteria 44249 pTetO Anhydrotetracycline Stanley Qi Anhydrotetracycline...Gram-negative bacteria. pAK Series Various Plasmids pTac GFP, Luciferase (LuxCDABE) Attila Karsi Broad host range...be found here . pAra Series Various Plasmids pBAD GFP Bryan Berger Reporter system for testing hetero- ...
  8. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...Parkinson's, FTD Michael Davidson 57146 mPA-GFP-MAPTau-N-10 MAPT GFP CMV Parkinson's, FTD Michael Davidson...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  9. Tetracycline Inducible Expression

    Type
    Collection
    ...option rtTA On Kowarz 16623 pBI-GFP Expression of your gene of interest & GFP from a bidirectional tet-responsive...Either Lung 11662 pPRIME-TET-GFP-FF3 Lentiviral, miRNA expression (PRIME) system for application in knockdown...cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None Either Elledge 35625...Safe Harbor Locus. Tet-On 3G On Doyon 58245 pGLTR-X-GFP Single vector lentiviral Gateway RNAi system for ...generation; contains expression cassette for TetR-P2A-GFP; see article for additional constructs TetR On Geley...inducible promoter at its 3' end, which controls GFP expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA...16542 pBI-MCS-EGFP Expression of your gene of interest (MCS with a β-globin poly A) & EGFP from a bidirectional...
  10. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...Plasmid 68295 GFP E17TAG Plasmid 68296 GFP S2TAG Plasmid 68297 GFP Q157TAG Plasmid 68298 GFP S2TAG/E17TAG...E17TAG Plasmid 68299 GFP E17TAG/Q157TAG Plasmid 53225 MBP-MEK1 S218TAG/S222TAG ( aka. PCRT7 tetR pLtetO MBP-MEK1...68305 Beta lactamase S68TAG Plasmid 69118 E17TAG GFP zeo resistance Strain 34929 BL21ΔserB Strain 52055... ( 188537 ) is a ROP minus plasmid and is not compatible with other plasmids containing high copy ColE1...
  11. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...technology. Titer values were then determined by comparison to a standard curve of a plasmid sample of known...Purity Purity of AAV preparations is assayed by comparing the relative stoichiometric ratios of the viral...
  12. Serotype Testing AAV

    Type
    Collection
    ...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...encode fluorescent reporters and can be used to compare the tropism of different serotypes. In addition... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...
  13. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...
  14. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008...autophagic flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an...
  15. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ...marker like GFP, researchers have turned dCas9 into a customizable DNA labeler compatible with fluorescence...detecting multiple genomic loci, and compatible with live cell imaging. Compared to techniques like fluorescence...
  16. Church Lab CRISPR Plasmids

    Type
    Collection
    ... to human AAVS1 41819 gRNA_GFP-T1 A gRNA to GFP 41820 gRNA_GFP-T2 A gRNA to GFP 41821 gRNA_DNMT3a-T1 A...Significantly smaller than the above Cas9 protein, NM is comparably active as a nuclease and a transcriptional activator...
  17. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... pX459 (Addgene plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...filter into a FACS tube. FACS sort the top ~3% of GFP positive cells in order to enrich for cells that ...repair. Deletions have potential advantages as compared to single-site small indels given the efficiency...cleavage site to ensure detection would not be impacted by a small indel at the sgRNA target site. Design...
  18. CRISPR References and Information

    Type
    Collection
    ...vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (...sequence (without PAM sequence) can be provided, to compare the predicted cleavage position to the position...sequencing, WGS datasets and allows the direct comparison of individual experiments. PubMed PMID 27404874...Musunuru CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Link O'Connor-Giles Fly: gRNA...plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF 2.3 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Kits are also available (mouse or human libraries...
  19. Antibody Production

    Type
    Collection
    ... not endogenously-expressed (e.g., using an anti-GFP antibody), the target antigen is first transiently...containing 1 mM sodium azide. This buffer is not compatible for use in live cells and will interfere with...secondary antibody. The fluorescence pattern is compared to an untransfected control. Immunohistochemistry...secondary antibody. The tissue labeling pattern is compared to the mRNA expression pattern cited in the Tissue...HRP-conjugated secondary antibody. Protein expression is compared to an untransfected control and the protein size...
  20. Luciferase Plasmids

    Type
    Collection
    ...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...phGluc Gaussia EF1α Expression of Gaussia luciferase; GFP is expressed if cells are infected with virus Christopher...Firefly TGB AAV expression of firefly luciferase and GFP James Wilson 106457 pCR3.1-Luc Firefly CMV Mammalian...Firefly luciferase. Plasmids are Gateway cloning compatible. Learn more about DULIP in our 27 Hot Plasmids...
Showing: 1 - 20 of 32 results