Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 20 results

  1. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...Collections Brzezinski Lab CRISPR Collection Brzezinski Lab CRISPR Collection The Brzezinski lab investigates...Cloning Protocol 237.2 KB Dual guide cloning: Brzezinski Lab Dual Guide Protocol 967.2 KB Plasmid and ...Schneider SR, Abraham J, Hensley A, Jones KL, Brzezinski JA Development. 2021 Jun 15;148(12). pii: 269198...PMID 34143204 Goodson NB, Kaufman MA, Park KU, Brzezinski JA 4th Development. 2020 Jul 3;147(13). pii:...

  2. Biosensor AAV Preps

    Type
    Collection
    ...dependent 1 Podgorski 135421 pAAV-syn-FLEX-axon-jYCaMP1s Syn jYCaMP1s none Cre dependent 1 Podgorski 135424...Constitutive 1 Podgorski 178331 pAAV.hSyn.iGluSnFR3.v857.GPI Syn iGluSnFr3 v857 none Constitutive 1 Podgorski Glutamate...pAAV-syn-jYCaMP1s Syn jYCaMP1s none Constitutive 1 Podgorski Calcium Sensor: CaMPARI 100831 pENN.AAV.CAG.Flex.CaMPARI.WPRE.SV40...PDGFR.codonopt Syn iGluSnFr3 v857 none Cre dependent 1 Podgorski 175181 pAAV.hSyn.FLEX.iGluSnFR3.v857.GPI.codonopt...GPI.codonopt Syn iGluSnFr3 v857 none Cre dependent 1 Podgorski 178329 pAAV.hSyn.iGluSnFR3.v857.PDGFR Syn iGluSnFr3...

  3. Rett Syndrome

    Type
    Collection
    ...30 months, is regression of previously acquired skills, notably loss of acquired purposeful hand movements...of speech. In contrast to the sustained loss of skills in neurodegenerative conditions, the regressive...developmental stabilization or even limited recovery of skills occurs. Diagnosis of Rett syndrome is currently...regression with a loss of spoken language and hand skills, development of repetitive hand stereotypies, and...

  4. Plasmids for Stem Cell Research

    Type
    Collection
    ...activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human Sox2, Nanog... vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells. Stem...Stem Cell. 2012 Apr 6;10(4):465-72. Schöler Adult Skin Fibroblasts Cholinergic Neurons Lentiviral Human...Cell Stem Cell. 2015 Nov 5;17(5):543-56. Buganim Skin Fibroblasts Motor Neurons Lentiviral Human Direct...

  5. Brain Initiative Collection

    Type
    Collection
    ...production or direct transfection, slow variant Kaspar Podgorski 135421-AAV1 pAAV-syn-FLEX-axon-jYCaMP1s Axon-targeted...production or direct transfection, slow variant Kaspar Podgorski 135424-AAV1 pAAV-syn-jYCaMP1s Yellow protein calcium...production or direct transfection, slow variant Kaspar Podgorski 135630-AAV1 pAAV-S5E2-dTom-nlsdTom AAV vector ...

  6. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...30 Frederic Mushinski 8418 pLTR PKC gamma PRKCG Spinocerebellar ataxia 29 Frederic Mushinski 8661 p4455...'s Gabriele Kaminski Schierle 108866 pT7-7 aSyn C141 SNCA T7 Parkinson's Gabriele Kaminski Schierle 108867...Gabriele Kaminski Schierle 108868 pLJM1 EGFP-Tau MAPT GFP CMV Parkinson's, FTD Gabriele Kaminski Schierle... Nicholas Tolwinski 160436 pUCIDT-attL1-Human ABeta-attR5 APP Alzheimer's Nicholas Tolwinski 160437 pUCIDT-attL1...ABeta-attR5 APP Cleavage signal Alzheimer's Nicholas Tolwinski 160541 pGS_101 APOE Kar2 GAL1 Alzheimer's Susan...

  7. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    .... pyogenes Matlashewski pSPneoHHgRNAH 63557 Other/Leishmania none S. pyogenes Matlashewski pLH-spsgRNA2...Mammalian U6x2 yes, nick S. pyogenes Puro Jackson pBluescriptSKII+ U6-sgRNA(F+E) empty 74707 Mammalian hU6 none...

  8. Cre-lox system

    Type
    Collection
    ...expression ApoE.HCR.hAAT Mammalian Ehmer 85797 pSkipFlox split Cre Pfcrt P. falxiparum Spielmann 86641 ...T2A-sfGFP-iCre-ERT2 sfGFP-iCre-ERT2 (PAPGSTM N-terminus, unskippable linker) - Tamoxifen inducible CAG Mammalian Capecchi...

  9. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...May 25. pii: 10.1038/s41592-020-0835-7. Kaspar Podgorski Calcium HaloCaMP1 chemigenetic calcium indicator...transmission. Nat Methods. 2023 May 4. Kaspar Podgorski Glutamate FRET sensor to monitor glutamate transport...

  10. Doudna Lab CRISPR Plasmids

    Type
    Collection
    ...Endonuclease in Adaptive Bacterial Immunity. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier ...

  13. AAVED

    Type
    Collection
    ...resources for this meeting's publication, we are asking participants to share practical information in ...

  14. Mammalian RNAi Tools

    Type
    Collection
    ...by RNA interference. Rubinson DA, Dillon CP, Kwiatkowski AV, Sievers C, Yang L, Kopinja J, Rooney DL, ...

  16. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Deisseroth K, Zhao F, Luo MH, Gong L, He M, Zhou P, Paninski L, Li B. 2017. The central amygdala controls learning...

  18. Immunology Research Plasmids and Resources

    Type
    Collection
    ...pathogen. It includes physical barriers such as the skin and mucosa, antimicrobial peptides and proteins ...chemokine (C-C motif) ligand 27 ALP, CTACK, CTAK, ESKINE, ILC, PESKY, SCYA27 CCL28 chemokine (C-C motif)...

  19. Validated gRNA Sequences

    Type
    Collection
    ...see article 69537 activate S. pyogenes 26352799 Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut...

  20. CRISPR Guide

    Type
    Collection
    ...Concepcion CP, Bonetti C, Vidigal JA, Han YC, Ogrodowski P, Crippa A, Rekhtman N, de Stanchina E, Lowe...
Showing: 1 - 20 of 20 results