Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 20 results for: tac promoter

Showing: 1 - 20 of 20 results

  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X.1 PINK1 KD PINK1 GST tac Parkinson's Mark ...DJ1-WT PARK7 GST tac Parkinson's Mark Cookson 29351 pGEX-5X-1-DJ1-D149A PARK7 GST tac Parkinson's Mark...DJ1-E64D PARK7 GST tac Parkinson's Mark Cookson 29353 pGEX-5X-1-DJ1-M26I PARK7 GST tac Parkinson's Mark ...44978 GST-FUS-WT FUS GST tac ALS Robin Reed 44981 GST-FUS 266-526 FUS GST tac ALS Robin Reed 44982 GST-FUS...GST-FUS 356-526 FUS GST tac ALS Robin Reed 44983 GST-FUS 465-526 FUS GST tac ALS Robin Reed 44984 GST-FUS...pGEX-parkin WT PRKN GST tac Parkinson's Kalle Gehring 45970 pGEX-parkin 77-465 PRKN GST tac Parkinson's Kalle...

  2. Bacterial Expression Systems

    Type
    Collection
    ...coli strain. Addgene Blog Inducible Promoters Repressible Promoters Synthetic Photobiology: Optogenetics...pRU1701 Promoter activity Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity...pCHERRY3 Promoter activity Fluorescence (mCherry) Mycobacterium sp. Tanya Parish 24657 pASTA3 Promoter activity...periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene Protein Purification...Toolkit (Addgene #1000000080) features a library of promoters and purification tags compatible with Golden Gate...temperature, in different bacterial systems. ID Plasmid Promoter Inducer Expression Species PI 44249 pdCas9-bacteria...extorquens Julia Vorholt 84693 pMyNT-kan Acetamidase promoter Acetamide Escherichia coli , Mycobacterium smegmatis...

  3. The Pleiades Promoter Project

    Type
    Collection
    ...Collections Pleiades Promoter Plasmids Pleiades Promoter Project The Pleiades Promoter Project (Link opens...Positive Control CAG promoter pEMS1293 cre N/A CAG promoter pEMS1164 EGFP/cre N/A CAG promoter pEMS1114 EGFP/...NLS N/A CAG promoter pEMS1157 EGFP/NLS N/A CAG promoter pEMS1277 EGFP/NLS N/A CAG promoter pEMS1294 intron-lacZ...Plasmids from the Pleiades Promoter Project - A regulatory toolbox of MiniPromoters to drive selective expression...mouse brain through these human MiniPromoters. Browse the Pleiades Promoter Plasmids using the table below...intron-lacZ/NLS N/A CAG promoter pEMS1488 intron-lacZ/NLS References Portales-Casamar, E., Swanson, D....Ple216 TAC1 pEMS1262 EGFP/NLS Ple217 TAC1 pEMS1263 EGFP/NLS Ple218 TAC3 pEMS1181 EGFP/NLS Ple219 TAC3 pEMS1182...

  4. Brain Initiative Collection

    Type
    Collection
    ...-mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 75033-AAV9 pAAV CD68-hM4D(Gi)-mCherry...mCherry Expression of hM4D(Gi) using the CD68 promoter. Bryan Roth 83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell...An AAV genome that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed...Cre-dependent expression of the tTA from the hSyn1 promoter. Contains a positive feedback loop for amplifed...recombinase-dependent expression of mNeonGreen from the CAG promoter Viviana Gradinaru 100798-AAV1 pAAV-syn-FLEX-splitTVA-EGFP-tTA...expression of the fluorescent protein EYFP from the CAG promoter Viviana Gradinaru 104055-AAV2 pAAV-CAG-eYFP An...expresses the fluorescent protein eYFP from the CAG promoter Viviana Gradinaru 104055-AAV5 pAAV-CAG-eYFP An...

  5. Validated gRNA Sequences

    Type
    Collection
    .... pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes 23977949... CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m promoter...S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate S. pyogenes 23977949...S. cerevisiae TGTATGTACATACAGTACCC 64386 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae...pyogenes 25161212 Fire sv40 promoter synthetic CATACTTCTGCCTGCTGGGGAGCCTG 62338 activate/interfere S. ... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...

  6. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...specific times or locations using cell-specific promoters or inducible systems, you can precisely control...fragments and placed under the control of different promoters. Expression of both fragments in the same cell... lox-STOP-lox shRNA constructs, Cre expression promotes shRNA expression. Gene Switch: These constructs...plasmids based on your expression system of choice, promoter, or search by inducible system (e.g., search for...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore our full...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search our full...

  7. mTOR Pathway

    Type
    Collection
    ...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth... which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR Pathway ...Cancer Pathway ORF Kit Ras Pathway p53 Pathway Tackling Cancers’ Drug Resistance with a New Screening ...Resources Cancer Pathway ORF Kit (Sabatini & Wood) Tackling Cancers’ Drug Resistance with a New Screening ...

  8. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    .... Therefore, the same reaction which ligates a promoter into an empty backbone can be repeated to ligate...ligate your gene of interest after the promoter, and so on. The following table provides information for... Suffix Enzymes: SpeI , NotI , PstI Scar: TACTAGAG or TACTAG Features: 8 bp Scar; No In-Frame Fusions;...

  9. Optogenetics Plasmid Collection

    Type
    Collection
    ...ID Plasmid Description Gene/Insert Vector Type Promoter Eligible for Viral Packaging PI Return to top ...ID Plasmid Description Gene/Insert Vector Type Promoter PI Return to top Content last reviewed: 25 September...control neuronal activity, scientists generally attach a fluorescent protein to the opsin in order to ...

  10. AAV Molecular Tools

    Type
    Collection
    ...Gradinaru 99120 pAAV-ihSyn1-tTA Inducible Synapsin promoter (ihSyn) Expression of the tet-off transactivator...pAAV-ihSyn1-DIO-tTA Cre-dependent and inducible Synapsin promoter (ihSyn) Cre-dependent expression of the tet-off... 2 Thomas Jessell , Eiman Azim 45580 pAAV-flex-taCasp3-TEVp EF1a-driven, Cre-dependent Cre-dependent, ..., bicistronic expression of designer pro-taCasp3 and TEVp for studying cell ablation. 1, 5 Nirao Shah ...

  11. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ...and dCas9 under a P-tet promoter integrated in the chromosome at phage attachment sites. The levels of the...integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed information about...

  12. Optogenetics AAV Preps

    Type
    Collection
    ...non-opsin) Jaws WiChR stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a...AAV5 AAV8 AAV9 AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2... 8 Edward Boyden 105669 pAAV-CKIIa-stGtACR2-FusionRed CaMKII GtACR2 (soma-targeted) FusionRed Constitutive...* Ofer Yizhar 105677 pAAV_hSyn1-SIO-stGtACR2-FusionRed Syn GtACR2 (soma-targeted) FusionRed Cre dependent...* Ofer Yizhar 105678 pAAV_hSyn1-SIO-stGtACR1-FusionRed Syn GtACR1 (soma-targeted) FusionRed Cre dependent...Yizhar 109048 pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST CAG eGtACR1 (soma-targeted) mRuby3 Cre dependent 9 ...

  14. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... or repression experiments use targets within promoters. Do you have gRNAs you'd like to add to the Addgene...the publication or plasmid information page, or contact the depositing PI for more information on the experimental...

  15. p53 Pathway

    Type
    Collection
    ... the best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in...early ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann ...

  16. CRISPR Guide

    Type
    Collection
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA - addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...

  17. Retrograde AAV viral preps

    Type
    Collection
    ...Inhibitors Other Molecular Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP...pAAV-CKIIa-stGtACR2-FusionRed CamKII Inhibitor Optogenetics Ofer Yizhar 105677 pAAV_hSyn1-SIO-stGtACR2-FusionRed...

  18. Deisseroth INTRSECT Collection

    Type
    Collection
    .... 2016. Serotonin engages an anxiety and fear-promoting circuit in the extended amygdala. Nature 537(7618... L, Lin JK, Wang M, Zhou L, Xu XH, Sun YG. 2019. Tac1-Expressing Neurons in the Periaqueductal Gray Facilitate...Facilitate the Itch-Scratching Cycle via Article Tac1-Expressing Neurons in the Periaqueductal Gray Facilitate...

  19. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... and heavy (blue) chains as driven by two CMV promoters (orange). Hybridoma-derived V L and V H domain...light chain polyA tail sequences (κ pA), a CMV promoter for heavy chain expression, and an ER signal/leader...the p1316 plasmid that contains an upstream CMV promoter for light chain expression, and an ER signal/leader...CASPR2 Human Mouse IgG2a 177447 Anti-Contactin/F3 [K73/20R] Contactin/F3 Rat Mouse IgG2a 177448 Anti-SK2...

  20. Immunology Research Plasmids and Resources

    Type
    Collection
    ...CXCL11 chemokine (C-X-C motif) ligand 11 H174, I-TAC, IP-9, IP9, MGC102770, SCYB11, SCYB9B, b-R1 CXCL12... MCH2, MCH2R, SLT MDK midkine (neurite growth-promoting factor 2) FLJ27379, MK, NEGF2 MET met proto-oncogene... different fluorescent proteins, 10 mammalian promoters and enhancers, 3 polyA signals as well as selection...STC-2, STCRP TAC1 tachykinin, precursor 1 Hs.2563, NK2, NKNA, NPK, TAC2 TACR1 tachykinin receptor 1 NK1R... cells such as macrophages and neutrophils that attack invading pathogens. Innate immune cells also process... to recognize a specific antigen, it finds and attacks pathogens or infected cells expressing that antigen...
Showing: 1 - 20 of 20 results