Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 12 results for: CaS

Showing: 1 - 12 of 12 results

  1. Plan Your Experiment

    Type
    Guide
    ...utilized for CRISPR/Cas gene editing. This image summarizes ways that the CRISPR/Cas system can be delivered...target cells translate the mRNA encoding Cas to produce the Cas enzyme, and the enzyme then forms a complex...directly combine purified Cas protein and in vitro transcribed gRNA to form a Cas-gRNA complex. You then ... joining (NHEJ) at the cut site Cas9 or Cas9 nickase High-fidelity Cas enzymes increase specificity Dual-nickase...components (Cas enzyme and guide RNA) for your experiment (Figure 1). You will decide how to express Cas9, the...generally only compatible with smaller Cas enzymes, like S. aureus Cas9. For more information, see our blog...deliver Cas-gRNA ribonucleoprotein (RNP) complexes directly into your target cells. In this case, your ...

  2. CRISPR Guide

    Type
    Guide
    ...type I Cas effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3...Base Editing with CRISPR CasPEDIA: A Functional Classification of Cas Enzymes Cas Enzymes and PAM Sequences...application. Cas9 Orthologs While SpCas9 is the most commonly used Cas enzyme, additional Cas9 orthologs ...editing with Cas3 Browse Plasmids: Cascade-Cas3 Want more information on the wide variety of Cas enzymes? ...from. Many variations of Cas9 exist, along with other Cas enzymes like Cas12a, which are available for...paired with the appropriate Cas enzyme. Specific enzymes, such as Cas12a or Cas13 , can improve multiplexing...Other natural Cas orthologs include Hsp1Cas9 (from Helicobacter sp. MIT 11-5569 ) and Nme2Cas9 (from Neisseria...

  3. Chemogenetics Guide

    Type
    Guide
    ...hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al., 2007 ...1670767 (Link opens in a new window) Tung JK, Gutekunst CA, Gross RE. (2015). Inhibitory luminopsins: genetically-encoded...

  4. Optogenetics Guide

    Type
    Guide
    ...Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson CA, Sabatini BL 2012. Novel recombinant adeno-associated...thus expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated...

  5. Adenovirus Guide

    Type
    Guide
    ...gene expression cassettes are often too big to be packaged in rAAV vectors. This is the case of some commonly...capacity is large enough to carry the Cas9 gene and a gRNA expression cassette in one single viral particle. ...production of replication-competent adenoviruses (RCAs) that would be able to infect cells and replicate...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain... or when needing to package larger cargo. CRISPR-Cas9 Delivery As compared to other viral vectors, rAdV...commonly used Cas9 homologs, especially when having to express them alongside a guide RNA and other regulatory...exposed. There is a risk of spontaneous reversion to RCAs, although this has been reduced by providing the...

  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...Addgene. CRISPR/Cas9 Delivery rAAV vectors are a popular choice for the delivery of CRISPR/Cas9 elements, making... genome editing. Packaging the Cas9 from Streptococcus pyogenes (SpCas9) and a gRNA together into an rAAV...this obstacle, has been to use smaller Cas9 orthologs, such as SaCas9 from Staphylococcus aureus . The Feng...regions between the two ITRs with a gene expression cassette that typically contains the transgene of interest...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...Feng Zhang lab has developed plasmids containing SaCas9 optimized for their use in rAAV vectors . Read ...too large to fit within the rAAV capsid, such as Cas9-derived plasmids and base/prime editors, is to create...

  7. Sequencing Primers

    Type
    Guide
    ... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer...beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of ...of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of...

  8. Guide to Using Pooled Libraries

    Type
    Guide
    ...the plasmids to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA ... Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those...information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out ...popular libraries! Genome-wide Screening Using CRISPR/Cas9 Lentiviral CRISPR Libraries Enable Genome-Scale,...

  9. Lentiviral Vector Guide

    Type
    Guide
    ...consideration for oncogenes should be made on a case-by-case basis. As with most experiments, infection risks...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain..., J. G., & Zhang, F. (2013). Genome-Scale CRISPR-CAS9 knockout screening in human cells. Science , 343...

  10. Antibody Guide

    Type
    Guide
    ...expression. Monoclonal antibodies are necessary in cases where extreme specificity is important. Their epitope...when epitope specificity is not a concern or in cases where you may want to identify or collect the protein...azide, as it acts as an inhibitor to HRP. In those cases, thimerosal can be used as an antimicrobial agent... using the above process and try again. In some cases, it may be preferable to buy small aliquots of many...

  11. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...consideration for oncogenes should be made on a case-by-case basis. Retroviruses carry a slightly elevated...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain...

  12. Cloning

    Type
    Guide
    ...promoters and into backbones with different selection cassettes). Although gateway cloning is a simple and efficient...
Showing: 1 - 12 of 12 results