Skip to main content

We narrowed to 16 results for: Cel

Showing: 1 - 16 of 16 results
  1. CRISPR Guide

    Type
    Guide
    ...with Haploid Embryonic Stem Cells Carrying a Guide RNA Library. Cell Stem Cell . 17 (2), 221–232. PMID: ...in the same cell. This is called multiplexing , and increases the likelihood that any cell containing ...can increase efficiency. Synchronizing cells or modulating the cell cycle can help as HDR takes place during...expressing stable cell line. After applying your screening conditions to your transduced cell population, you...tracking of RNA in live cells, including orthogonal RNA/DNA labeling in the same cell. Figure 11: Overview...promiscuity is unique to bacterial cells and does not occur in mammalian cells. SHERLOCK , developed by the ...editing systems by manipulating cellular determinants of editing outcomes. Cell . 184 (22), 5635-5652.e29. ...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...production cell line, typically human embryonic kidney 293T (HEK293T) cells. Standard HEK293T cells are sufficient...fluorescence-activated cell sorting (FACS) is used to sort cells expressing GFP and later expanded into a cell line. More...in a variety of cell types and models. Lentiviral vectors can target non-dividing cells, enable stable ...actively dividing cell types, whereas gamma-retroviruses can only infect mitotically active cell types. This...transfected into HEK293T cells using your preferred transfection method. The HEK293T cells will produce the viral...make stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there... specifically dictate the target cell population and reduce cellular toxicity. Common Uses of Lentiviral...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...-activated cell sorting (FACS) is used to sort cells expressing GFP and later, sorted cells are expanded...actively dividing cell types, whereas gamma-retroviruses can only infect mitotically active cell types. This...Using Packaging Cell Lines Gamma-retroviral vectors can be packaged using helper-free cell lines (Figure...-retroviral packaging cell line developed by Garry Nolan at Stanford. These cell lines contain gag-pol...and rat cells), or an amphotropic envelope, Phoenix-AMPHO (for the infection of mammalian cells). Using...make stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there... — T and B cell transduction Murine Leukemia Virus (MuLV) and HIV glycoprotein — CD4+ cell transduction...
  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...based on other human cell lines, such as HeLa and A549 cells, and even insect Sf9 cells , have also been ...able to infect cells and replicate autonomously. Human embryonic kidney 293T (HEK293T) cells are the most...HEK293T cells are then extracted and purified for their use as viral vectors to deliver genes to cells in ...persist in non-dividing cells for a period of years without damaging the host cell. Episomal stability allows...broad range of cell types in vivo. AAV-DJ has been optimized further for specific cell and tissue types...co-delivered to the host cells. The full-length transgene is later reconstructed within the cell via different mechanisms...main cell body, or soma, towards the synapse at the axons. Blood-brain barrier (BBB) Layer of cells that...
  5. Antibody Guide

    Type
    Guide
    ... produced. Cells - Antibodies can also be produced in cell cultures using hybridomas, cell cultures created...created by fusing B cells with myeloma cells (immortalized B cells). The genetic reorganization that creates...identify and sort cells from a mixed population. Overview of application Collect cells from cell culture or ...specificity occurs in the B cell itself prior to antibody production; therefore, each B cell only produces one ... specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express...determines the isotype of the antibody. B cells, the immune cell responsible for producing antibodies, can...mature B cell can clone itself to enable higher production of a single antibody, but each B cell can only...
  6. Plan Your Experiment

    Type
    Guide
    ...difficult-to-transfect cells. You can direct expression to specific cell types by using cell-specific promoters...human embryonic kidney 293 (HEK293) cells. For more difficult cell types, you may need to look into other...are good choices for more difficult cell types like primary cells. For CRISPR delivery, lentiviral and...deliver to target cells through microinjection or electroporation. The target cells translate the mRNA...complexes directly into your target cells. In this case, your target cells are not transcribing DNA to mRNA...possible genotypes within the resulting cell population. Some cells may remain wild type due to either (1...modifications . Cell Population The first step of validation is determining the type of cell population you...
  7. Adenovirus Guide

    Type
    Guide
    ...enters the host cell, and encode proteins necessary for viral DNA replication and host cell manipulation....expressed by the packaging cell line, normally the human embryonic kidney 293 (HEK293) cell line. There is a rare...transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli cells containing pAdEasy. pAdEasy... construct flanked by ITRs. Cells from the packaging HEK293 or HER911 cell lines expressing E1 are transfected...HER911 cells throughout viral vector production. During experiments, GFP can be used to sort cells infected...transfected into HER911 E4+ cells for rAdV vector production, as HEK293 cells do not contain E4. Download...immune cells and antibody production that develops after exposure to an antigen. AdEasier-1 cells BJ5183...
  8. Guide to Using Pooled Libraries

    Type
    Guide
    ...to mark individual cells. These barcodes will then be inherited by any daughter cells, making barcode libraries...experiment, target cells are treated with the pooled library to create a population of mutant cells that are then...200x more cells than plasmids in the TKO library for their screen. Using large numbers of cells minimizes...selection, most cells die or do not pass selection (in the case of a reporter) Sort selected cells Sequence ...) Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results between...identify those cells that do not survive the selection mechanism. You’ll transduce two sets of cells and subject...sequences, screening certain types of proteins (such as cell surface receptors or transcription factors), or ...
  9. Optogenetics Guide

    Type
    Guide
    ...photoreceptor cells are light-sensitive rhodopsins. Expressing these natural proteins in non-native cell types...generator; can be used to disrupt cellular function or ablate cells local generation of reactive oxygen...defined subpopulation of cells at the viral injection site, rather than in all cells. For example, using a.... Molecular and cellular approaches for diversifying and extending optogenetics. Cell, 141 (1), 154–165...combines optics and genetic engineering to manipulate cells and biomolecular processes with light. Light-activated...precise control of electrical activity in a target cell type. OptoXRs are chimeras of a G-protein coupled...interrogate and control a wide variety of processes across cell types. Check out our blog for practical tips , explore...
  10. Molecular Biology Reference

    Type
    Guide
    ... plasmid DNA is replicated upon cell division, and each daughter cell receives at least one copy of the...segregated to the resulting daughter cells. These daughter cells are called clones, since they contain...non-coding RNA (ncRNA) and play important roles in cellular processes and gene regulation. Regions that code...techniques enable the isolation and purification of cellular components, such as DNA, but in practice this ..., which take up plasmids and amplify them during cell division. Because bacteria are easy to grow, divide...long-term, either as purified DNA or within bacterial cells that have been preserved as glycerol stocks. Function...including plants, worms, mice, and cultured human cells. Have diverse applications — Although plasmids were...
  11. Chemogenetics Guide

    Type
    Guide
    ...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression of...actuators for specific cellular pathways, receptors, or ion channels targeted to specific cell populations (most...signaling, allowing precise control over a targeted cell population. Read this guide to learn more, or explore...coupled receptors (GPCRs) . The largest class of cell surface receptors, GPCRs are seven-pass transmembrane...stimulating phospholipase C, which releases intracellular calcium stores. There are currently three Gq...and activate neuronal signaling by increasing intracellular cAMP concentrations. There is currently one ... was created by replacing the corresponding intracellular region of a turkey erythrocyte β-adrenergic ...
  12. Sequencing Primers

    Type
    Guide
    ...CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse ...CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1...pLXSN 5' (MSCV) CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT...
  13. Modular Cloning Guide

    Type
    Guide
    ...assembly of cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can...MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete... create multigene constructs expressed in the cellulose-producing Komagataeibacter species. Ralstonia-...
  14. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...
  15. Promoters

    Type
    Guide
    ...element controls the rate of transcription. Bacterial cells contain sigma factors that assist the RNA polymerase...other promoters can drive expression in specific cells or under different conditions. Promoter Expression...ribosomal RNA (rRNA), which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...
  16. Molecular Cloning Techniques

    Type
    Guide
    ...homology. While this approach doesn't work in other cell types, it can be a major time- and cost-saver for...
Showing: 1 - 16 of 16 results