Skip to main content

We narrowed to 15 results for: PLE;

Showing: 1 - 15 of 15 results
  1. Antibody Guide

    Type
    Guide
    ...antibody in assays with multiple targets, and is described in more detail in the Multiplex Assays section below...fragments (shown in Figure 2) to completely unrelated molecules. Examples include: scFv - Single-chain fragment...differentiation between multiple antibodies. They are often used in assays that have multiple proteins to detect...application Collect and lyse samples to make proteins available. Tissue samples may need additional processing...proteins from a complex mix. Overview of application Process the tissue or cell culture samples to extract ...capture protein:DNA complexes. After capture, the DNA is released from the complex and can be sequenced...culture samples to extract proteins. Homogenize (tissues only) and lyse. Cross-link the samples with formaldehyde...
  2. CRISPR Guide

    Type
    Guide
    ... C RISPR- as sociated c omplex for a ntiviral de fense; a complex of multiple Cas enzymes including Cas8...edits carried out by Cas9. Multiplexing applications include editing multiple genes at once; using dual...detail later. Read more about Cas9 multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9...also has more condensed multiplexing capabilities , as it can process multiple gRNAs under a single promoter...can be added to SHERLOCKv2 to detect multiple targets. For example, Cas12 can be added to detect the presence...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex to initiate DNA degradation. Cascade...have extended CRISPR applications to increasingly complex functions, including the ability to selectively...
  3. Modular Cloning Guide

    Type
    Guide
    ...sequence at the restriction cut site, multiple modules with complementary overhangs can be digested and ligated...assembly. Combining multiple Level 2 vectors permits the creation of even more complex constructs constrained... MoClo) is a system for efficiently assembling multiple DNA parts into functional plasmids. It is a powerful...vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding...modules and components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression...overexpression, gene editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible... MoBiFC - Modular Bimolecular Fluorescence Complementation Toolkit Plant Expression Benjamin Field 50 ...
  4. Guide to Using Pooled Libraries

    Type
    Guide
    ...experiments using a pooled CRISPR library are far more complex than using CRISPR to modify a single genomic locus...about CRISPR tools in our CRISPR Guide . There are multiple types of CRISPR libraries: Knockout : CRISPR knockout...folding and post-translational modification of complex eukaryotic proteins, such as antibodies. Advantages...screens, pathway discovery, and functional complementation. Advantages Strong and uniform overexpression... expression Cannot capture regulatory/isoform complexity shRNA/RNAi shRNA libraries permit reversible ...and noncoding RNA studies. Each library contains multiple shRNA sequences for each target gene – a true ...screen should show consistent results from the multiple shRNAs that target it. shRNA libraries may also...
  5. Optogenetics Guide

    Type
    Guide
    ...combine multiple opsins with different activation wavelengths in the same experiment. For example, you could...cell type. OptoXRs are chimeras of a G-protein coupled receptor (GPCR) and an opsin engineered to activate...including a brief overview of the wild-type and some examples of relevant variants. Channelrhodopsins Channelrhodopsins... variants to enhance the functionality of ChR. Examples of ChRs from other species include CoChR (from...variants result in the hyperpolarization of neurons. Examples of anion channel variants from other species include... be difficult to control precisely due to the complexity of these signaling networks and other limitations...the localization of a protein of interest. For example, a genetically-encoded nuclear Cry2 fusion can ...
  6. Chemogenetics Guide

    Type
    Guide
    ...chemogenetic receptors were based on G-protein coupled receptors (GPCRs) . The largest class of cell surface...like RASSLs, are based on engineered G-protein coupled receptors, but unlike RASSLs, show insensitivity...classified by the signaling protein that the receptors couple to. Gq-DREADDs Gq-DREADDs signal through the Gαq...is not widely used. There is also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling...For a discussion of alternative DREADD ligands, please see the text. PSAMs Unlike DREADDs, which manipulate...allowed them to respond to their cognate PSEM. For example, PSAM Q79G,Q139G is activated by PSEM 22S , while...developed as agonists for PSAM4. A given PSAM is coupled with an ion pore domain (IPD) to form ligand-gated...
  7. Molecular Cloning Techniques

    Type
    Guide
    ...overhang (blunt ends). Two pieces of DNA that have complementary overhangs, or which are both blunt-ended, can...popular restriction enzyme sites, usually within the multiple cloning site (MCS). You can easily move (subclone...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and...restriction cloning, once your project has been completed via Gateway cloning. Addgene's collection contains...method that relies on the hybridization of the complementary base pairs adenine (A) and thymine (T). TOPO...overhang on the 3' end of PCR products. The complementary T comes from a pre-cut, linear, cloning-ready... cloning is that it allows for the assembly of multiple fragments of DNA in the chosen orientation at ...
  8. Molecular Biology Reference

    Type
    Guide
    ...combinations and only 20 natural amino acids, so multiple codons can encode the same amino acid — a phenomenon... vary broadly in their functionality. In their simplest form, plasmids require a bacterial origin of replication...providing a survival advantage to the bacterial host. Multiple Cloning Site (MCS) A short segment of DNA which... DNA fragments. Cloning vectors tend to be very simple, often containing only a bacterial resistance gene... as cloned DNA, and this process of generating multiple identical copies of a recombinant DNA molecule...for Plasmid Selection Each bacterium can contain multiple copies of an individual plasmid, and ideally would...pressure to maintain and replicate your plasmid over multiple generations. It is important to distinguish that...
  9. Plan Your Experiment

    Type
    Guide
    ...CRISPR/Cas9 in mammalian cells as an example, but many of these principles also apply to using CRISPR in other...while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA designs... process of interest. Do you want to: Generate complete and permanent loss of gene expression or function...perfect world, your gRNA sequence would be an exact complement to your target sequence with no homologous sites...selecting a gRNA, but you likely won’t be able to completely avoid them. To increase specificity, consider...the genomic region you intend to target in your samples to ensure there are no discrepancies with the reference...produce the Cas enzyme, and the enzyme then forms a complex with the gRNA for CRISPR activity. Because you ...
  10. Promoters

    Type
    Guide
    ... transcription is simpler than eukaryotic transcription, bacteria still have complex systems of gene regulation... including transcription and the transcription complex. Educational...other hand, the process in eukaryotes is much more complex. Eukaryotes require a minimum of seven transcription...transcription. The Lac operon in bacteria is an example of a negatively-controlled operon (Figure 3). A...involved in the production of tryptophan is an example of a positively-controlled operon. Figure 3: Lac...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span... start site (TSS). Eukaryotic promoters are so complex in structure that the DNA tends to fold back on...
  11. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...as adenovirus or herpes simplex virus to replicate in the host cell and complete the lytic cycle. AAVs ...transduction efficiency and alter tropism. For example, AAV2/5, targets neurons that are not efficiently...Hybrid capsids are engineered capsids derived from multiple different serotypes, which can further alter transduction...transduction efficiency and viral tropism. One common example is AAV-DJ, which contains a hybrid capsid derived...blog post on AAVrg for more information. Self-complementary AAV (scAAV) One downside of the use of AAVs ...DNA replication machinery to synthesize the complementary strand, transgene expression may be delayed....capacity of rAAV vectors to ~2.4 kb. Figure 4: Examples of AAV serotypes, pseudotypes, hybrid capsids,...
  12. Lentiviral Vector Guide

    Type
    Guide
    ...hence the use of “retro”. Lentiviruses have more complex genomes, containing packaging genes and accessory...along with virus-specific accessory genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs...comparison of second- and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral...integration sites have led to the development of multiple genome-wide analysis pipelines to assess viral...Timms et al. (2018), and Wells et al. (2020) for examples). Pseudotyping Tropism dictates which types of...in the envelope and packaging plasmids. Unless multiple recombination events occur between the packaging.... (2021). CReVIS-Seq: A highly accurate and multiplexable method for genome-wide mapping of lentiviral...
  13. Adenovirus Guide

    Type
    Guide
    ...genomes range between 26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted...harvested about 7–10 days later. Vogelstein designed multiple shuttle plasmids for different purposes. The pAdTrack...that the infection rates are equivalent across multiple viruses. The adenoviral backbone plasmid pAdEasy...transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5/26 combine the high transduction...packaging capacity. Large protein-coding genes and complex gene expression cassettes are often too big to ... also been developed as vaccine candidates for multiple infectious diseases and prostate cancer. Cancer...
  14. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... — hence the use of “retro”. Retroviruses have simpler genomes, containing only the necessary packaging...transfection step of the viral packaging cell line. For example, Phoenix™ is a popular second-generation gamma-...in the envelope and packaging plasmids. Unless multiple recombination events occur between the packaging...Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of Retroviral Vector Design. In Retroviruses ...
  15. Sequencing Primers

    Type
    Guide
    ...from most sequencing services, along with a more complete list of common sequencing primers. These lists...molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular Biology Reference page...pGL3 vector Forward SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG...
Showing: 1 - 15 of 15 results