Skip to main content
Addgene

We narrowed to 12 results for: RET

Showing: 1 - 12 of 12 results
  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Read our gamma-retroviral guide to learn about gamma-retroviral components, retroviral production, and...Vectors Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors Vector...Glossary Gamma-retroviruses are a subtype of retrovirus and belong to the Retroviridae family. Gamma-retrovirus...Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome of retroviruses is made of RNA...pseudotype most gamma-retroviral vectors. Glossary Term Definition Gamma-retrovirus A retrovirus from the Retroviridae...decades. Wildtype gamma-retroviruses have been engineered into gamma-retroviral vectors that can be safely...glossary at the end! Browse retroviral plasmids available at Addgene. Gamma-Retrovirus Versus Lentivirus Lentiviruses...
  2. Lentiviral Vector Guide

    Type
    Guide
    ... Versus Gamma-Retrovirus Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome...Glossary Lentiviruses are a type of retrovirus and belong to the Retroviridae family. Infection with lentiviruses...variety of cell types than retroviruses. Both lentiviruses and gamma-retroviruses use the same packaging ...packaged by gamma-retroviral packaging systems, and vice versa. For more about gamma-retroviruses, see Addgene's..., leading to disease. Lentivirus A retrovirus from the Retroviridae family. Characterized by long incubation...BIV), and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability...of viruses in this family is made of RNA. This retroviral RNA is reverse transcribed into DNA before being...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction.... Browse Addgene’s in-stock viral preps . AAV retrograde (AAVrg) Directed evolution has also been employed...treat a diversity of diseases such as inherited retinal disease, spinal muscular atrophy, hemophilia A ...capable of both anterograde (from soma to axon) and retrograde (from axon to soma) transport. Many rAAV vectors... use with rabies virus (RABV) in monosynaptic retrograde tracing of neurons. In this system, the rAAV ...2016). A designer AAV variant permits efficient retrograde access to projection neurons . Neuron, 92 (2)... and the adenoviral genes provided in trans . Retrograde transport Movement of molecules, vesicles or ...
  4. Modular Cloning Guide

    Type
    Guide
    ...) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete and Detect Yeast...Penicillium or Aspergillus species. MoClo Yeast Secretion and Display (YSD) Toolkit Yeast Expression Paul...Plasmids to generate transcription units for protein secretion in yeasts S. cerevisiae and P. pastoris (a.k.a... MoClo-YTK toolkit for protein expression and secretion in P. pastoris (a.k.a. K. phaffii ). GoldenPiCS...RBS strength variants, 8 tag-compatible RBSs, 2 secretion tags, 6 CDSs, 9 terminators, 4 nonfunctional "...
  5. CRISPR Guide

    Type
    Guide
    ...coding sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...Cas9 Fusion Tools dCas9 cannot cleave DNA, but it retains the ability to find specific DNA targets through...specificity, and editors carrying an ADAR truncation that retain RNA editing capabilities but are small enough to...23979020 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W.,...., Terns, M. P., White, M. F., Yakunin, A. F., Garrett, R. A., Van Der Oost, J., . . . Koonin, E. V. (...: 32572269 Charpentier, M., Khedher, A. H. Y., Menoret, S., Brion, A., Lamribet, K., Dardillac, E., Boix...
  6. Molecular Biology Reference

    Type
    Guide
    ...plasmids through cell division. To ensure the retention of plasmid DNA in bacterial populations, an antibiotic...these conditions, there is a selective pressure to retain the plasmid DNA, despite the added replication ...to create viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles, that can infect...
  7. Antibody Guide

    Type
    Guide
    ... Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus) where it protects... your samples using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific...upwards of twenty. Laser and software capacity theoretically allow for roughly fifty different fluorophore...
  8. Cloning

    Type
    Guide
    ...final product, with no undesired sequence ("scar") retained. A disadvantage of type IIS assembly cloning systems...restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation...
  9. Chemogenetics Guide

    Type
    Guide
    ...chemogenetic access to optogenetic tools, they also retain the ability to be activated by standard optogenetics...chemogenetic control in a single molecule driven by FRET-modified bioluminescence. Neurophotonics. 11:021005...
  10. Science Guides

    Type
    Guide
    ...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...
  11. Addgene's eBook Collection

    Type
    Guide
    ...for choosing a fluorescent protein; information on FRET, biosensors, and monitoring protein localization...
  12. Sequencing Primers

    Type
    Guide
    ...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322...
Showing: 1 - 12 of 12 results