...populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin) is included...providing a benefit to the host, such as antibiotic resistance. This benefit can be context-dependent, and thus...of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments...includes a DNA replication origin, an antibiotic-resistance gene, and a region in which exogenous DNA fragments... origin of replication ( ori ), an antibiotic-resistance gene, and at least one unique restriction enzyme...plasmids are convenient and easy to use. Antibiotic Resistance Gene Allows for selection of plasmid-containing... important to distinguish that the antibiotic resistance gene is under the control of a bacterial promoter...

...including resistances to chemotherapy drugs and toxins, cell viability, and tumor metastasis. One of the...editing systems include targeted AID-mediated mutagenesis (TAM) and CRISPR-X , in which Cas9 is fused to...nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting), developed by Samuel H. Sternberg’s...large scale edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed...desired phenotype. The ease of gRNA design and synthesis, as well as the ability to target almost any genomic...simplest dCas9-based activators and repressors consist of dCas9 fused directly to a single transcriptional...than other activators/repressors due to their persistence and heritability. Not all modifications are stable...

...markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. When...plasmids do not have selectable markers conferring resistance to an antibiotic, but do encode another marker... interest using PCR. The process of subcloning consists of digesting the insert of interest from its parent...replication-competent lentivirus The potential for oncogenesis The potential for generation of replication-competent...incorporated into a host cell. The potential for oncogenesis is largely based on the specific insert contained...oncogene) and should be considered on a case by case basis. Biosafety should always be considered with respect...polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency and transgene...

...Components The small (4.8 kb) ssDNA AAV genome consists of two open reading frames, Rep and Cap, flanked...repeats (ITRs). These ITRs base pair to allow for synthesis of the complementary DNA strand. Rep and Cap are...double-stranded circular episome through double stranded synthesis. These episomes can concatemerize, producing high...episomes can develop chromatin-like organization and persist in non-dividing cells for a period of years without...a lytic cycle are quickly released through cell lysis. Episomal stability enables long-term transgene ... eliminates the requirement for host cell DNA synthesis. Unfortunately, this technique further limits ...promote efficient transduction independently of DNA synthesis. McCarty DM, Monahan PE, Samulski RJ. Gene Ther...

...neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, ...Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA...

...equivalent called the Pribnow box which usually consists of the six nucleotides, TATAAT. Proximal Promoter...position, simply titled the -35 element, typically consists of the sequence TTGACA and this element controls...transcription. Bacterial cells contain sigma factors which assist the RNA polymerase in binding to the promoter region...have also been discovered in eukaryotes. Operons consist of a promoter, which is recognized by the RNA polymerase... structure. Ribosomes are the site of protein syntehsis where mRNA is translated into a protein. RNA polymerase...

... chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and ChR2 450-470 C1V1 ChR1-VChR1 chimera...improve upon previous tools through directed mutagenesis - use Addgene's Optical Switch Plasmid Table ...Blue-light–mediated induction of protein interactions based on Arabidopsis thaliana cryptochrome 2 and CIB1 450 LARIAT Inhibits...OPTOSTIM PHR domain2 of cryptochrome 2 (Cry2) from Arabidopsis thaliana is fused to truncated forms of cytosolic...optogenetic tools derived from direct comparative analysis of microbial opsins. Nat Methods. 9(2):159-72....

...CRISPR libraries include: resistance to the anti-cancer drug vemurafenib , resistance to Clostridium septicum...phenotype, and allow you to design additional hypothesis-directed experiments. As you might have guessed...septicum alpha-toxin , and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing...

... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...specific proteins or protein complexes for downstream analysis. They are powerful tools for understanding protein...complex and can be sequenced and amplified for analysis. Overview of application Process tissue or cell...crosslink, isolate DNA, and perform downstream analysis. Special considerations One type of ChIP assay...

...sequencing, vectors, and restriction enzymes to assist with your molecular biology research. Topics include...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...

...creating adenoviral vector constructs. The system consists of two types of plasmids: shuttle (or transfer...

...polypurine tract; recognition site for proviral DNA synthesis. Increases transduction efficiency and transgene...

...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...

...Manipulation for Ameliorating Huntington's Disease Pathogenesis. iScience , in press. Magnus CJ, Lee PH, Atasoy...