We narrowed to 14 results for: VIT
-
TypeGuide...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer...primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ...
-
Chemogenetics Guide
TypeGuide...unlike RASSLs, show insensitivity to endogenous ligands, have low constitutive activity, and their activating...control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD Receptor...plasmids in your lab for interrogation of neuronal activity. Science...receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs Designer...was shown to have a small amount of constitutive activity, and is not widely used. There is also a DREADD...Compound 21 and DCZ seem to have minimal off-target activity, and do not seem to have the same back-metabolism...PSAMs Unlike DREADDs, which manipulate neuronal activity indirectly through GPCR signaling, another class... -
CRISPR Guide
TypeGuide...SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY - NRN/NYN, where R ...nuclease activity Cas9 enzymes will likely improve as more key residues for specificity and activity are discovered...select for gRNAs with high on-target activity and low off-target activity. Knockout libraries often target...engineered to increase specificity and nuclease activity available. Engineered Cas9s have also led to reduced...off-target effects Sniper-Cas9 - less off-target activity; compatible with truncated gRNAs to increase specificity...about Cas9 variants . Anti-CRISPR Prolonged Cas9 activity can increase the risk of off-target cutting or...(Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages and other... -
Plan Your Experiment
TypeGuide...proteins) Many base editors fused to Cas9 exert their activity within a very narrow window proximal to the PAM...essential protein domain could abolish protein activity and essentially function as a “knockout,” but ...gRNAs Based On Predicted On-Target and Off-Target Activity Another important factor to keep in mind when ...is the balance between on-target and off-target activity. In a perfect world, your gRNA sequence would ...with higher fidelity. In addition to off-target activity, it is also important to consider factors that...cleavage of the desired target sequence, or on-target activity. Two gRNA targeting sequences with 100% homology...sequence and your genomic target may reduce the gRNA activity. Be sure to sequence the genomic region you intend... -
Optogenetics Guide
TypeGuide... the following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude...salinarum (strain Shark), used to silence neuronal activity 632 Halo/NpHR Light-driven inward chloride pump...Natronomonas pharaonis , used to silence neuronal activity 589 eNpHR 3.0 NpHR with addition of trafficking...from Halorubrum strain TP009. Improved light sensitivity over Arch. 566 eArchT 3.0 ArchT with addition...exquisite spatial and temporal control of protein activity. Phytochrome, cryptochrome, and LOV (light oxygen...described above, both LOV and Dronpa can control activity of a fused protein through allosteric interactions...Rhodopseudomonas palustris bacteria. Key feature is the sensitivity to 740- to 780-nm near-infrared light. 740–780... -
Molecular Biology Reference
TypeGuide...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...luciferase or GFP) that offers a read-out of the activity of the genetic element. For instance, a promoter... rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen F- gyrA462 endA Delta(sr1-recA) mcrB mrr hsdS20...proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 ...rpsL (StrR) rph spoT1 ∆(mrr-hsdRMS-mcrBC) Stbl3 Invitrogen F– mcrB mrr hsdS20 (rB–, mB–) recA13 supE44 ara...proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 ...a test tube to copy DNA regions of interest. In vitro DNA replication requires the 4 nucleotides, a DNA... -
Adeno-associated virus (AAV) Guide
TypeGuide...transduction efficiency in vitro than any wild-type serotype, and a very high infectivity across a broad range...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...with rAAV vectors include the Allen Mouse Brain Connectivity Atlas and the Janelia Campus MouseLight project... RNA translation, and promotes RNA transcript longevity. Located between WPRE and 3'ITR. Not required ... elements into the genome, often altering gene activity. Latent infection A state where a pathogen is ...Optogenetics Biological technique to control the activity of cells, often neurons, with light. Pseudotyping...proteins from different species. Used to alter infectivity and tropism. Recombinant adeno-associated viral... -
Lentiviral Vector Guide
TypeGuide...packaging gene env (usually VSV-G due to wide infectivity) VSV-G (vesicular stomatitis virus G protein)... gene in all systems, due to a wide range of infectivity for different cell types (known as tropism). ...common envelope gene, as it has a wide range of infectivity across many cell types and enhances the stability...also gained popularity to further enhance both infectivity and specificity. Pseudotyped lentiviral vectors...2007). Role of PSIP1/LEDGF/p75 in Lentiviral Infectivity and Integration Targeting. PLoS ONE , 2 (12),...proteins from different species. Used to alter infectivity and tropism. Replication-competent The ability... -
Cloning
TypeGuide... Cloning (LIC) relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme...strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs of 10-12 base ...this opportunity, T4 will resume its polymerase activity, add back the free base, and become stuck at this...principle to Gibson cloning, but instead of an in vitro reaction with purified enzymes, it takes advantage... -
Gamma-Retroviral Vector Guide
TypeGuide...packaging gene env ; usually VSV-G due to wide infectivity VSV-G (vesicular stomatitis virus G protein) ...common envelope gene, due to a wide range of infectivity for different cell types (known as tropism). ...common envelope gene, as it has a wide range of infectivity across many cell types and enhances the stability...proteins from different species. Used to alter infectivity and tropism. Replication-competent The ability... -
Antibody Guide
TypeGuide...(~25 kD), but tend to have lower affinity and longevity. Single-domain antibodies - Single-domain antibodies...monoclonal antibodies tend to have less cross-reactivity and give lower background signals than polyclonal...interest is knocked down or out, and antibody reactivity is compared between the wild-type and the knockdown...cell line with low or no expression; antibody reactivity is then compared between the knock-in cell line... -
Adenovirus Guide
TypeGuide... elements into the genome, often altering gene activity. Oncolytic Referring to the destruction of cancer...proteins from different species. Used to alter infectivity and tropism. pShuttle Class of shuttle/transfer... -
Science Guides
TypeGuide...molecules, which allows for specific control of activity. Read More CRISPR Class 2 C lustered R egularly... -
Promoters
TypeGuide...transcription of a gene is initiated. Promoters are a vital component of expression vectors because they control...