Skip to main content
Addgene

We narrowed to 14 results for: plasmids 101

Showing: 1 - 14 of 14 results
  1. Addgene's eBook Collection

    Type
    Guide
    ... Download Select Plasmids 101 September 2023 | Fourth Edition About Plasmids 101 September 2023 ...popular Plasmids 101 blog series, this eBook covers everything you need to know about plasmids, from parts...About Overlay Select CRISPR 101 January 2021 | Third Edition About CRISPR 101 January 2021 | Third...Fluorescent Proteins 101 August 2017 | First Edition About Fluorescent Proteins 101 August 2017 | ... Select Viral Vectors 101 July 2024 | Second Edition About Viral Vectors 101 July 2024 | Second... Select CRISPR 101 en español January 2024 | First Edition, trans. About CRISPR 101 en español January...nuestro libro electrónico, CRISPR 101. Close About Overlay Select Antibodies 101 New! October 2024 | First...
  2. Educational Resources

    Type
    Guide
    .... Titles include: Plasmids 101 CRISPR 101 Viral Vectors 101 Fluorescent Proteins 101 Science Career Guide...Viral Vectors Plasmid Technology Career Readiness Molecular Biology Learn about plasmids, sequencing, ...biology, plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning...include: Protocols Careers How-to Blog Read about plasmids in Addgene’s repository , and related molecular...Concentrations for Bacterial Selection What is a Plasmid? Genetic Code Strain Information Molecular Cloning...
  3. Cloning

    Type
    Guide
    ...of interest (YGOI) into a recipient plasmid. (Image from Plasmid 101: Restriction cloning ) Back to Top...Recombination Cloning Gateway cloning (Image from Plasmid 101: Gateway Cloning ) Gateway® cloning is a recombination.... Back to Top TOPO® Cloning TOPO (Image from Plasmid 101: TOPO Cloning ) Toposiomerase based cloning, ...product into a plasmid. The major disadvantage of TOPO® cloning is that very few plasmid backbones are ...Entry plasmids are also available, allowing for rapid cloning of PCR products into donor plasmids without... For more information and tips check out our Plasmid 101 blog post on TOPO cloning. Back to Top Gibson... 5' exonuclease. Gibson Assembly (Image from Plasmid 101: Gibson Assembly ) Back to Top Type IIS Assembly...
  4. Promoters

    Type
    Guide
    ...biology basics and plasmid components. Plasmids 101: The Promoter Region-Let's Go Plasmids 101: Inducible Promoters...Promoters Plasmids 101: Repressible Promoters Plasmids 101: Terminators and PolyA signals... popular Plasmids 101 series , covers topics ranging from the newest breakthroughs in plasmid technologies... Plasmid Reference Molecular Biology Reference Promoters...
  5. Molecular Biology Reference

    Type
    Guide
    ...Restriction Cloning Plasmids 101: Inducible Promoters Plasmids 101: What is a plasmid? Plasmids 101: Antibiotic...biology basics and plasmid components. Plasmids 101: Origin of Replication Plasmids 101: The Promoter Region-Let...Reference Guide Plasmids 101: 5 factors to help you choose the right cloning method Plasmids 101: Restriction...Molecular Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains ...propagating plasmids Antibiotics commonly used for plasmid selection DNA sequencing for plasmid verification...to be studied into the plasmid. Below are some common plasmid elements: Plasmid Element Description Origin...our popular Plasmids 101 series covers topics ranging from the newest breakthroughs in plasmid technologies...
  6. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...different plasmid. In order to produce rAAV vectors, three plasmids are needed: Transfer plasmid (also known...the packaging plasmid. For a summary of all AAV plasmid components, see the AAV Plasmid Elements table...addgene.org AAV Plasmids Available at Addgene Viral Vectors 101 eBook Viral Vectors 101 Youtube Videos ...as cis plasmid) — containing the transgene of interest between the two ITRs. Packaging plasmid (also known...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ...Production The three production plasmids (transfer, packaging, and helper plasmid) are transfected into cells...Optogenetics 101 video or by visiting Addgene's Optogenetics Guide . Browse optogenetics plasmids available...
  7. Plan Your Experiment

    Type
    Guide
    ...generate stable cell lines (for details, see Plasmids 101: Mammalian Vectors ) Transient or stable expression...Additionally, many plasmids containing validated gRNAs are now available through Addgene. These plasmids contain ...particular model organism. There may not be a perfect plasmid for your specific application, and in such cases...different activators exist, including the multi-plasmid SAM system. Select Expression System To use CRISPR...and enrich positive cells Packaging and envelope plasmids provide the necessary components to make lentiviral...Read more about how to design your gRNA . Browse Plasmids: gRNAs Synthesize and clone desired gRNAs Once...oligos are synthesized, annealed, and inserted into plasmids containing the gRNA scaffold using standard restriction-ligation...
  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Gamma-Retroviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ... of all gamma-retroviral plasmid components, see the Gamma-Retroviral Plasmid Elements table . In order...gamma-retroviral vectors, you need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or ...capacity Packaging plasmid — contains packaging genes gag and pol Envelope plasmid — contains packaging...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ...on separate plasmids ( in trans ). This method, therefore, reduces the number of plasmids that are required...different plasmids containing the transfer, envelope, or packaging components. The transfer plasmid encodes...
  9. Adenovirus Guide

    Type
    Guide
    ...you generally need two plasmids: Shuttle plasmid (also known as transfer plasmid) — containing the transgene...shuttle plasmid. For a summary of all adenoviral plasmid components, see the Adenoviral Plasmid Elements...for recombination with the adenoviral plasmid. Adenoviral plasmid — containing the rest of the adenoviral...chosen plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be ...consists of two plasmids that eventually recombine to form one: Shuttle/transfer plasmid (e.g. pAdTrack...backbone plasmid containing the adenoviral genes necessary for virus production. The shuttle plasmid and the...shuttle plasmid, but this method results in a higher background of non-recombinant adenoviral plasmids. Recombinant...
  10. Lentiviral Vector Guide

    Type
    Guide
    ...second-generation transfer plasmids as well. Third-generation plasmids include (Figure 4): Transfer plasmid — contains...Packaging plasmid 1 — contains gag and pol Packaging plasmid 2 — contains rev Envelope plasmid — contains...systems Packaging Plasmid One plasmid encoding gag , pol , tat , and rev Two plasmids, one encoding gag...Lentiviral Plasmid Elements Plasmid Type Element Delivery relative to transgene Purpose Transfer plasmid LTR ...separated into distinct plasmids for safety. For a summary of all lentiviral plasmid components, see the ...four, for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest ...rev ; separated into two plasmids in third generation systems Envelope plasmid — contains packaging gene...
  11. CRISPR Guide

    Type
    Guide
    ...editing CRISPR 101: Homology directed repair CRISPR 101: Validating your genomic edit CRISPR 101: Multiplex...Blog References Website CRISPR plasmids and resources at Addgene CRISPR 101 eBook (3rd edition) CRISPR software...Addgene's guide to using CRISPR plasmids in your lab, from knockouts to pooled library screening. Science... cell must be validated experimentally. Browse Plasmids: Double-Strand Break (Cut) Multiplex Genome Engineering...cases, delivering multiple gRNAs using a single plasmid ensures that all gRNAs will be expressed in the...likelihood that any cell containing the CRISPR plasmid will have all desired genomic edits carried out...genetic loci by cloning multiple gRNAs into a single plasmid — though some have achieved targeting in the double...
  12. Chemogenetics Guide

    Type
    Guide
    ... chemogenetics plasmids available through Addgene, check out our Chemogenetics Plasmid Collection . Figure...Preparations of Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity...Want to know more about FLEx vectors? Read our Plasmids 101: FLEx Vectors blog! Download our chemogenetics...Addgene's guide to using Chemogenetics plasmids in your lab for interrogation of neuronal activity. Science...the text. Browse Addgene's collection of DREADD plasmids ! PSAMs Unlike DREADDs, which manipulate neuronal... al., 2011 Browse Addgene's collection of PSAM plasmids ! LMOs Luminopsins (LMOs), or luminescent opsins...et al., 2025 Browse Addgene's collection of LMO plasmids ! Planning Your Chemogenetics Experiment If you're...
  13. Optogenetics Guide

    Type
    Guide
    ... check out our Biosensors Plasmid Collection . To find optogenetics plasmids available through Addgene...mutagenesis - use Addgene's Optical Switch Plasmid Table to search for plasmids for your next experiment. For a ...domain (iLID plasmid), while its natural binding partner SspB is included in a separate plasmid; Blue light...Addgene's guide to using Optogenetics plasmids in your lab, including explanations of microbial opsin...Addgene, check out our Optogenetics Plasmid Collection . Microbial Opsins Opsins are light-gated ion channels... of opsins here to find the right optogenetics plasmids for your experiments. Channelrhodopsins Channelrhodopsins...SwiChRca, Phobos, Aurora Browse Channelrhodospin plasmids . Halorhodopsins Halorhodopsins are light-gated...
  14. Sequencing Primers

    Type
    Guide
    ... For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert...uses for sequence verification of deposited plasmids. Plasmid... Plasmid Reference Molecular Biology Reference Sequencing... useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' ... for sanger sequence verification of deposited plasmids. Below is a list of commonly used primers. This...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT ... stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early...
Showing: 1 - 14 of 14 results