Skip to main content
Addgene

We narrowed to 17 results for: ran

Showing: 1 - 17 of 17 results
  1. CRISPR Guide

    Type
    Guide
    ..., 1163–1171. PMID: 23979020 Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D...38688943 Hsu, P. D., Scott, D. A., Weinstein, J. A., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine..., 17 (5), 471–479. PMID: 32203383 Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I....CRISPR-Cas9. Cell , 167 (7), 1829-1838.e9. PMID: 27984730 Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott...Nature Protocols , 8 (11), 2281–2308. PMID: 24157548 Ran, F. A., Cong, L., Yan, W. X., Scott, D. A., Gootenberg...may be a single-stranded oligonucleotide, double-stranded linear DNA, or a double-stranded DNA plasmid. ...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...deletion is transferred to the 5’ LTR after one round of reverse transcription, inhibiting transcription of the...cannot be used in direct transfections for transient expression of a transgene. For more detailed protocols... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...packaging plasmids. tat in trans Trans-activator; binds TAR to activate transcription from the LTR promoter...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially... typically ranges from 8–10 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...for third generation) plasmids: Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses...plasmids are needed: Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...three production plasmids (transfer, packaging, and helper plasmid) are transfected into cells which then ... to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction of movement...machinery to synthesize the complementary strand, transgene expression may be delayed. To overcome this...express a viral element necessary for RABV trans-synaptic transport. Learn more about these and other initiatives...
  4. Adenovirus Guide

    Type
    Guide
    ... the transduced cells, transgene expression delivered through rAdV vectors is normally transient and short-lived...Adenoviral genomes range between 26–45 kb in length and contain multiple heavily-spliced transcripts flanked by...double-stranded DNA genome. Adeno-associated viruses (AAV), however, are small single-stranded DNA viruses... and late adenoviral transcript regions between the two ITRs with the transgenes of interest. The size...Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest, the ITRs, and homology...possibility that recombination between the transfected adenoviral transfer plasmid and the E1 region integrated...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...
  5. Promoters

    Type
    Guide
    ... sense or coding strand of the transcribed gene. The coding strand is the DNA strand that encodes codons...to the mRNA transcript produced. The antisense strand is referred to as the template strand or non-coding...non-coding strand as this is the strand that is transcribed by the RNA polymerase. DNA sequences called response...initiation of transcription whereas transcription factors promote the initiation of transcription. The most...template for the translation of a protein. RNA polymerase III transcribes genes encoding transfer RNAs (tRNA...reference material covering promoters, transcription and the transcription complex. Plasmid... to DNA. RNA polymerase transcribes DNA to mRNA which is ultimately translated into a functional protein...
  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... Increases transduction efficiency and transgene expression. Packaging plasmid gag in trans Precursor ...crossover event between the transfer plasmid and genes provided in trans . Transduction The process of artificially...gamma-retroviruses ranges from 9–11 kb, encoded on RNA (Figure 1). This RNA is reverse transcribed into the provirus...need three plasmids (Figure 2): Transfer plasmid — contains transgene, sgRNA, or shRNA of interest flanked...Production Cloning Cloning your transgene, gRNA, or shRNA of interest into the transfer plasmid can be done with...described above (envelope, packaging, and transfer) are co-transfected into the HEK293T packaging cell line... at random locations throughout the genome. Gamma-retroviral vectors tend to prefer transcription start...
  7. Plan Your Experiment

    Type
    Guide
    ...fused to transcriptional activators that need to be within a given range of the transcription start site... interfere with transcription elongation. CRISPR Activation : Target the transcription start site. CRISPRa... perform by chemical transfection or electroporation. Expression can be transient, or you can generate...efficiently transfect. However, note that this method is most useful for cell lines that you can transfect at ...into cells. These methods are more transient than plasmid transfection or viral vectors, reducing the risk...your target cells are not transcribing DNA to mRNA, nor do they need to translate mRNA to protein. Instead...is helpful in cells that are difficult to transfect, transduce, or may not express common promoters. Browse...
  8. Molecular Biology Reference

    Type
    Guide
    ...molecular biology, that proteins are translated from RNA, which is transcribed from DNA. DNA is comprised of ...Region Drives transcription of the insert. The promoter is designed to recruit transcriptional machinery ... a base on one strand pairs with a particular base on the other, complementary, strand. Specifically, ... single stranded DNA adding nucleotides according to the sequence of the complementary strand. The replication...on the random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition...respectively) that are organized into a double stranded helix. The order of these 4 nucleotides makes ... determinant. Plasmids are fragments of double-stranded DNA that typically carry genes and can replicate...
  9. Optogenetics Guide

    Type
    Guide
    ...wavelengths, ranging from blue to yellow to red. Red light exhibits better tissue penetrance, which may ...including protein activation, membrane localization, and transcriptional activation. In the widely used...synthetic two-part transcription factors - Cry2 and CIB1 are fused to a transcriptional activation domain...trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described below... at physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic...from Kir2.1 and ER export signal provide improved membrane targeting 589 Archaerhodopsins Arch Light-activated...neuronal activation/inactivation periods. These can range from msec (hChR2) to “long lasting,” e.g. seconds...
  10. Modular Cloning Guide

    Type
    Guide
    ... mammalian expression vectors for transient or stable transfections. PUF Assembly Kit Mammalian Expression...nucleases (TALENs) and transcription factors (TALE-TFs) for genome editing and transcription modulation applications...assembled into a Level 1 vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a ...E. coli to maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components...multigene constructs. MoClo Plant Parts III: Transformation & Genome Engineering Kit Plant Expression, ...several cassettes and generate multi-construct transgenic plants. GreenGate 2.0 Toolkit Plant Expression...components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression Wayne...
  11. Antibody Guide

    Type
    Guide
    ...proteins by size. Transfer proteins from the gel to a membrane. Incubate the membrane with an unconjugated...block the membrane to remove excess antibody and prevent unwanted binding. Incubate the membrane with a ...Wash and block the membrane. Activate the HRP with a substrate kit. Image the membrane using either X-ray...hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express antibodies....variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...constant region, and is shown in dark blue and dark orange. The constant region is a stable part of the antibody...responsible for the variable region goes through a randomized reorganization process, creating a unique binding...
  12. Cloning

    Type
    Guide
    ...by certain bacteria and archaea, cleave double stranded DNA (dsDNA) at specific sequence sites in the ...into fragments containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt .... They also cut specific target sequences, that range from 4 to 13 base pairs, and produce predictable...' end of dsDNA fragments to generate 3' single-stranded overhangs. DNA polymerases synthesize DNA molecules... 4 nucleotides and lastly DNA ligase fuses DNA strands together. In Gibson assembly DNA fragments with...nicks in the DNA to create one piece of double stranded DNA. A major benefit of Gibson cloning is that...enzyme or Gateway recombination sites). Any double stranded DNA fragments can be used, so if properly designed...
  13. Chemogenetics Guide

    Type
    Guide
    ...cell surface receptors, GPCRs are seven-pass transmembrane proteins that bind a specific ligand. Ligand...initiating signaling pathways in inflammation and neurotransmission. This, and the fact that GPCR ligands can ...in Japan, making it an attractive option for translational studies, however, it has off-target effects....hM4Di, and is especially attractive for use in translational studies because it is FDA and EMA approved. ...muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima & Wess, 2012 hM3Dq...2009). Remote control of neuronal activity in transgenic mice expressing evolved G protein-coupled receptors...26889809 (Link opens in a new window) Slaviero AN, Gorantla N, Simkins J, Crespo EL, Ikefuama EC, Tree MO,...
  14. Sequencing Primers

    Type
    Guide
    ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter... CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...
  15. Educational Resources

    Type
    Guide
    ...protocols, our educational resources cover a wide range of topics in molecular biology, laboratory research...Protocols Find written and video protocols for a wide range of applications in molecular biology, plasmid cloning...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...
  16. Addgene's eBook Collection

    Type
    Guide
    ...First Edition, trans. About CRISPR 101 en español January 2024 | First Edition, trans. About Una traducción...and management, resources for identifying your transferable skills, and tips on the job application process...
  17. Guide to Using Pooled Libraries

    Type
    Guide
    ...Barcoding libraries contain plasmids with unique, semi-random sequences that can be used for applications like...large numbers of cells minimizes the effects of random chance that could lead to false positive or negative...
Showing: 1 - 17 of 17 results