Skip to main content

dCAS9-VP64_GFP
(Plasmid #61422)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61422 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Concentrated Lentiviral Prep 61422-LVC Virus (50µL at titer ≥ 2.5×10⁶ TU/mL) and Plasmid. $221

Backbone

  • Vector backbone
    lenti(AMP)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    GFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    none
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCAS9(D10A,H840A)-VP64_2A_GFP
  • Species
    Synthetic; S. pyogenes
  • Mutation
    D10A and H840A in Cas9
  • Promoter EF1A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GTT TGG ATC TTG GTT CAT TCT CAA GCC TCA G
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/

Information for Concentrated Lentiviral Prep (Catalog # 61422-LVC) ( Back to top)

Purpose

Ready-to-use Concentrated Lentiviral Prep particles produced from dCAS9-VP64_GFP (#61422). In addition to the viral particles, you will also receive purified dCAS9-VP64_GFP plasmid DNA.

Delivery

  • Volume 50 µL
  • Titer ≥2.5×10⁶ TU/mL
  • Pricing $189 USD for preparation of 50 µL virus + $32 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer PBS
  • Selectable Marker GFP
  • Purification Lentivirus was harvested from cell culture medium (DMEM + 10% FBS). Lentiviral particles were then collected by precipitation in polyethylene glycol (PEG) followed by centrifugation. Precipitated pellets containing viral particles were resuspended in PBS.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Titering Method:
  • ddPCR assay: 293T cells were transduced with serial dilutions of 61422-LV, harvested several days later, and genomic DNA was isolated. Copies of RRE were measured and normalized to RPP30.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting dCas9 and the WPRE element. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: dCas9-F2 CCAAAGAGGTGCTGGACG
    Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dCAS9-VP64_GFP was a gift from Feng Zhang (Addgene plasmid # 61422 ; http://n2t.net/addgene:61422 ; RRID:Addgene_61422) For viral preps, please replace (Addgene plasmid # 61422) in the above sentence with: (Addgene viral prep # 61422-LVC)
  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202