Skip to main content

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
203915 pWR91 CRF1 plus flanking (Other) Robertson Jun 25, 2024
203914 pWR90 GSC2 plus flanking (Other) Robertson Jun 25, 2024
203423 pWR89 EGC3 plus flanking (Other) Robertson Jun 25, 2024
203422 pWR88 CAR copy 1 (Other), P(TEF1)/coKanMX/T(ACT1) + P(TDH3)/coCBG/T(ADH2) (Synthetic), CAR copy 2 (Other) Robertson Jun 25, 2024
203336 pWR63(YUM1) TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), CCW12 promoter (S. stipitis) (Other), CaCas9 (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other), THD3 promoter (S. stipitis) (Other), tRNA-sgRNA(SapI)-HDV (Synthetic), ADH1 terminator (S. stipitis) (Other), YUM1-targeting sequence (Synthetic) Robertson Jun 25, 2024
203331 pWR63 TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), CCW12 promoter (S. stipitis) (Other), CaCas9 (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other), THD3 promoter (S. stipitis) (Other), tRNA-sgRNA(SapI)-HDV (Synthetic), ADH1 terminator (S. stipitis) (Other) Robertson Jun 25, 2024
202776 pWR76 TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCherry, ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
202770 pWR23 TEF1 promoter (S. stipitis) (Other), coKanMX (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCBG (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
220352 MSCV-LMP2A-IRES-GFP LMP2A (Other) Rajewsky Jun 25, 2024
220351 MSCV-LMP1-IRES-mCherry LMP1 (Other) Rajewsky Jun 25, 2024
220350 MSCV-LMP1-IRES-GFP LMP1 (Other) Rajewsky Jun 25, 2024
220355 MSCV-opEBNA2-IRES-mCherry opEBNA2 (Other) Rajewsky Jun 25, 2024
220354 MSCV-opEBNA2-IRES-GFP opEBNA2 (Other) Rajewsky Jun 25, 2024
220353 MSCV-LMP2A-IRES-mCherry LMP2A (Other) Rajewsky Jun 25, 2024
202710 pWR10 TEF1 promoter (S. stipitis) (Other), coShBle (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCBG (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
202645 pWR9 TEF1 promoter (S. stipitis) (Other), coHPH (Synthetic), ACT1 terminator (S. stipitis) (Other), TDH3 promoter (S. stipitis) (Other), coCBG (Synthetic), ADH2 terminator (S. stipitis) (Other), ARS from S. stipitis chromosome 1 (Other) Robertson Jun 25, 2024
217611 ZIF-NLS-EGFP*-HOTag6-T2A-CEL-EGFP-YAP ZIF-NLS-EGFP*-HOTag6-T2A-CEL-EGFP-YAP (Homo sapiens) Shu Jun 25, 2024
131683 pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH EGFP-KASH (Synthetic), SpCas9 sgRNA vs mouse GRID1 (Mus musculus) Richie Jun 25, 2024
131684 pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH EGFP-KASH (Synthetic), SpCas9 sgRNA vs mouse GRID1 (Mus musculus) Richie Jun 25, 2024
195018 pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs CCGTATAGGCGGCTGCCCAA (Mus musculus), EGFP-KASH (Synthetic), TTCCGTGGTGGGCAACGTAG (Mus musculus) Richie Jun 25, 2024
131682 pOTTC1553 - pAAV EF1a EGFP-KASH EGFP-KASH (Synthetic) Richie Jun 25, 2024
207815 p663-UBC-miniTurbo-V5-NRF3 miniTurbo-V5-NRF3 (Homo sapiens) Major Jun 25, 2024
213497 pCC1R pcaU, nahR, rpaR, phlF, cinR, vanR, aiiA Isalan Jun 25, 2024
216522 pYES2/NTA/Leu-LegA7ΔNAnk290 LegA7 ΔNAnk290 (Other) Isberg Jun 25, 2024
216521 pYES2/NTA/Leu-LegA7ΔNAnk264 LegA7 ΔNAnk264 (Other) Isberg Jun 25, 2024
216520 pYES2/NTA/Leu-LegA7ΔAnk290 LegA7 ΔAnk290 (Other) Isberg Jun 25, 2024
216519 pYES2/NTA/Leu-LegA7Δank LegA7 ΔAnk (Other) Isberg Jun 25, 2024
216518 pYES2/NTA/Leu-LegA7 Leg A7 (Other) Isberg Jun 25, 2024
216365 pDG04439 xhNup133-Nb2t (+2Cys) Görlich Jun 25, 2024
216376 pTP789 xY-Nb1t (+2Cys) Görlich Jun 25, 2024
216375 pMSC226 xhNup358-Nb2t (+3Cys) Görlich Jun 25, 2024
216374 pTP728 xNup358-Nb1t (+3Cys) Görlich Jun 25, 2024
216373 pDG04163 xhNup214-Nb1t (+2Cys) Görlich Jun 25, 2024
216372 pMSC235 xhNup155-Nb3i (+2Cys) Görlich Jun 25, 2024
216371 pMSC261 xhNup155-Nb3i Görlich Jun 25, 2024
216370 pMSC99 xhNup155-Nb3i Görlich Jun 25, 2024
216369 pMSC100 xhNup155-Nb2i Görlich Jun 25, 2024
216368 pMSC236 xhNup155-Nb2i (+2Cys) Görlich Jun 25, 2024
216367 pMSC263 xhNup155-Nb2i Görlich Jun 25, 2024
216366 pTP489 xNup155-Nb1t (+3Cys) Görlich Jun 25, 2024
216364 pMSC130 xhNup98-Nb3i Görlich Jun 25, 2024
216363 pMSC264 xhNup98-Nb2i Görlich Jun 25, 2024
216362 pMSC129 xhNup98-Nb2i Görlich Jun 25, 2024
216361 pTP443 xNup98-Nb1t (+1Cys) Görlich Jun 25, 2024
216360 pMSC233 xhNup93-Nb4i (+2Cys) Görlich Jun 25, 2024
216359 pMSC262 xhNup93-Nb4i Görlich Jun 25, 2024
216358 pMSC98 xhNup93-Nb4i Görlich Jun 25, 2024
216357 pMSC234 xhNup93-Nb3t (+2Cys) Görlich Jun 25, 2024
216356 pMSC115 xNup93-Nb2t Görlich Jun 25, 2024
216355 pTP416 xNup93-Nb1t (+1Cys) Görlich Jun 25, 2024