Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
180427 pBBR1-kan-Ptet-plu-gamma-ET_rhi145 plu-gamma-ET_rhi145 (Synthetic) Fu Apr 27, 2022
178575 pLenti-GFAP-CRY2PHR-P2A-CIBN-mCherry-VAMP2 CRY2PHR-P2A-CIBN-mCherry-VAMP2 Heo Apr 27, 2022
183815 pLenti-CD74-ROS1 L2000V ROS Proto-Oncogene 1, Receptor Tyrosine Kinase (Homo sapiens), CD74 molecule (Homo sapiens) Hata Apr 27, 2022
178573 pcDNA3.1-CMV-CIBN-mCherry-VAMP2 CIBN-mCherry-VAMP2 Heo Apr 27, 2022
183814 pLenti-CD74-ROS1 G2032R ROS Proto-Oncogene 1, Receptor Tyrosine Kinase (Homo sapiens), CD74 molecule (Homo sapiens) Hata Apr 27, 2022
178576 pAAV-CK(0.4)-CRY2PHR-P2A-CIBN-mCherry-VAMP2 CRY2PHR-P2A-CIBN-mCherry-VAMP2 Heo Apr 27, 2022
178574 pLenti-CamKIIα-CRY2PHR-P2A-CIBN-mCherry-VAMP2 CRY2PHR-P2A-CIBN-mCherry-VAMP2 Heo Apr 27, 2022
182925 pDEST-cDNA5-FRT/TO-3*Flag-APEX2 N-term Blencowe Apr 27, 2022
140956 pHB-3 phaCAB (Other) Zhou Apr 27, 2022
140955 pHB-2 phaCAB (Other) Zhou Apr 27, 2022
104508 pILGFP4M SeGAL2 promoter-yEGFP (Other) Vickers Apr 27, 2022
182243 pcDNA GFP10-ZIP-GFP11 GFP10-ZIP-11 (Synthetic) Cabantous Apr 26, 2022
182240 pET N6his GFP1-9 GFP1-9 (Synthetic) Cabantous Apr 26, 2022
183170 pUC19/mChe-Px mCherry-Px (Synthetic) Zhu Apr 26, 2022
182687 pR0306 CcaCas13b His6-TwinStrep-SUMO CcaCas13b (Other) Zhang Apr 26, 2022
183169 pUC19/mChe-Golgi mCherry-Golgi (Synthetic) Zhu Apr 26, 2022
183165 pUC19/Tp-mChe Tp-mCherry (Synthetic) Zhu Apr 26, 2022
183172 pUC19/Pd-mChe Pd-mCherry (Synthetic) Zhu Apr 26, 2022
183171 pUC19/mChe-Cs mCherry-Cs (Synthetic) Zhu Apr 26, 2022
180176 pRB133 GluN2A (Rattus norvegicus) Bergeron Apr 26, 2022
183162 pUC19/NLS-mChe NLS-mCherry (Synthetic) Zhu Apr 26, 2022
183164 pUC19/Pt-mChe Pt-mCherry (Synthetic) Zhu Apr 26, 2022
183163 pUC19/ER-mChe ER-mCherry (Synthetic) Zhu Apr 26, 2022
167730 BirA-Myc_N_TLX1 TLX1 (Homo sapiens) Varjosalo Apr 26, 2022
167728 BirA-Myc_N_TAL1 TAL1 (Homo sapiens) Varjosalo Apr 26, 2022
167726 BirA-Myc_N_SP1 SP1 (Homo sapiens) Varjosalo Apr 26, 2022
167721 BirA-Myc_N_PAX6 PAX6 (Homo sapiens) Varjosalo Apr 26, 2022
167716 BirA-Myc_N_MYOD1 MYOD1 (Homo sapiens) Varjosalo Apr 26, 2022
167715 BirA-Myc_N_MYC MYC (Homo sapiens) Varjosalo Apr 26, 2022
167710 BirA-Myc_N_HNF1a HNF1a (Homo sapiens) Varjosalo Apr 26, 2022
183173 pYL1300UaUf Zhu Apr 26, 2022
167709 BirA-Myc_N_HME1 HME1 (Homo sapiens) Varjosalo Apr 26, 2022
176714 pYCTK010 mfalpha1Ka (Other) Sourjik Apr 26, 2022
167708 BirA-Myc_N_HEN1 HEN1 (Homo sapiens) Varjosalo Apr 26, 2022
183158 pUC19/Vc-C Zhu Apr 26, 2022
167703 BirA-Myc_N_FOXL1 FOXL1 (Homo sapiens) Varjosalo Apr 26, 2022
176710 pYCTK006 P-SST2 (Saccharomyces cerevisiae) Sourjik Apr 26, 2022
183157 pUC19/N-Vc Zhu Apr 26, 2022
167702 BirA-Myc_N_FOXI1 FOXI1 (Homo sapiens) Varjosalo Apr 26, 2022
183160 pUC19/mChe-C Zhu Apr 26, 2022
183159 pUC19/N-mChe Zhu Apr 26, 2022
167700 BirA-Myc_N_ETS1 ETS1 (Homo sapiens) Varjosalo Apr 26, 2022
183155 pUC19/N-eCFP Zhu Apr 26, 2022
184464 PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 PRDM9(KRAB-SSXRD-PR/SET-ZF1-dC)-Cas9 (Homo sapiens) Doudna Apr 26, 2022
172092 IMPT-2070 Homo sapiens adenosine A2a receptor (ADORA2A) (Homo sapiens) Stevens Apr 26, 2022
183054 pGL3 RARE-RFP RFP Kalcheim Apr 26, 2022
183055 pGL3 RARE-d2EGFP d2EGFP Kalcheim Apr 26, 2022
182497 pTET GFP10-FRB/FKBP-GFP11 FRB (Homo sapiens), FKBP (Mus musculus) Cabantous Apr 26, 2022
180000 pKB233.3 mNeonGreen (Other) Tabor Apr 26, 2022
181976 pLeGO.sgGata1.4.RUNX1A.iG2 GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) Klusmann Apr 26, 2022