169,804 results
-
Viral Prep#107787-AAV8PurposeReady-to-use AAV8 particles produced from AAV.TBG.PI.Cre.rBG (#107787). In addition to the viral particles, you will also receive purified AAV.TBG.PI.Cre.rBG plasmid DNA. TBG-driven expression of Cre. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTBGAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only
-
psPAX2
Plasmid#12260Purpose2nd generation lentiviral packaging plasmid. Can be used with 2nd or 3rd generation lentiviral vectors and envelope expressing plasmid (Addgene#12259)DepositorTypeEmpty backboneUseLentiviral; PackagingExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV.TBG.PI.Null.bGH (AAV8)
Viral Prep#105536-AAV8PurposeReady-to-use AAV8 particles produced from pAAV.TBG.PI.Null.bGH (#105536). In addition to the viral particles, you will also receive purified pAAV.TBG.PI.Null.bGH plasmid DNA. AAV vector with TBG promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTBGAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Luciferase-pcDNA3
Plasmid#18964DepositorInsertFirefly Luciferase
ExpressionMammalianAvailable SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pMD2.G
Plasmid#12259PurposeVSV-G envelope expressing plasmidDepositorInsertVSV G
UseLentiviral; EnvelopeExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459) V2.0
Plasmid#62988PurposeCas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorHas ServiceCloning Grade DNAInserthSpCas9-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCbhAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CMV-MCS-Puro
Plasmid#219794PurposeMammalian expression plasmids using piggyBac Transposon SystemDepositorTypeEmpty backboneUsePiggybac transposonExpressionMammalianAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-PEmax for IVT
Plasmid#178113PurposeTemplate for in vitro transcription of PEmaxDepositorInsertPEmax
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSMutationDetailed in manuscriptPromoterT7 (inactivated)Available SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-hM4D(Gi)-mCherry (AAV5)
Viral Prep#50479-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-GFAP-hM4D(Gi)-mCherry (#50479). In addition to the viral particles, you will also receive purified pAAV-GFAP-hM4D(Gi)-mCherry plasmid DNA. GFAP-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPTagsmCherryAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)-Is-PETase
Plasmid#112202PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1), codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6, codon optimized for expression in E. coli K12
Tags6XHISExpressionBacterialPromoterN/AAvailable SinceJuly 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMax_GFP
Plasmid#177825PurposeHost Cell Reactivation (HCR) control GFP plasmid (pMax backbone)DepositorInsertGFP
ExpressionMammalianPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSV-Rev
Plasmid#12253Purpose3rd generation lentiviral packaging plasmid; Contains Rev; also requires pMDLg/pRRE (Addgene#12251) and envelope expressing plasmid (Addgene#12259)DepositorAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMKV057
Plasmid#133312PurposeBeYDV viral replicon on T-DNA backbone expressing Firefly Luc+, WUS2 and IPTDepositorInsertLuc+. WUS2, IPT
ExpressionPlantPromoterAtUbi10, Nos, 35SAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV9)
Viral Prep#44361-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRGFP
Plasmid#26475PurposeIn vivo homologous recombination substrate composed of two differentially mutated GFP genes oriented as direct repeats and separated by a drug selection markerDepositorInsertDRGFP
ExpressionMammalianAvailable SinceOct. 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmax
Plasmid#174820PurposeMammalian expression of SpCas9 PEmax prime editorDepositorInsertPEmax
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.GCaMP6f.WPRE.SV40 (AAV1)
Viral Prep#100837-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.Syn.GCaMP6f.WPRE.SV40 (#100837). In addition to the viral particles, you will also receive purified pAAV.Syn.GCaMP6f.WPRE.SV40 plasmid DNA. Syn-driven GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.cTNT.PI.eGFP.WPRE.rBG (AAV9)
Viral Prep#105543-AAV9PurposeReady-to-use AAV9 particles produced from pENN.AAV.cTNT.PI.eGFP.WPRE.rBG (#105543). In addition to the viral particles, you will also receive purified pENN.AAV.cTNT.PI.eGFP.WPRE.rBG plasmid DNA. cTNT-driven eGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromotercTNTTagsEGFPAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RLUC POLIRES FLUC
Plasmid#45642PurposeBicistronic reporter plasmid expressing Renilla luciferase and firefly luciferase in mammalian cells.DepositorInsertRLUC - IRES - FLUC
UseLuciferaseExpressionMammalianAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only