We narrowed to 2,781 results for: ada.2
-
Plasmid#178645PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TMDepositorInsertTAPBPR (TAPBPL Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationswitched transmembrane domain with that of MHC-IPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short
Plasmid#72552Purposeexpresses 3*FLAG tagged human NSD3-shortDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutationnonePromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-mEKLF
Plasmid#67833PurposeExpression of FL-EKLF driven by SV40 promoterDepositorInsertEKLF (Klf1 Mouse)
TagsFLAGExpressionMammalianMutationFull-length mEKLF is aa 20-376; amino acid 19 is …PromoterSV40Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb1
Plasmid#162793PurposeCcnb1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T2 gp78 G2BR mt / JM26
Plasmid#13308DepositorInsertgp78 (AMFR Human)
TagsGSTExpressionBacterialMutationcDNA corresponds to aa309-643 derived from human …Available SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-gp78 Cue-m1,2 / JM22
Plasmid#13305DepositorInsertgp78 (AMFR Human)
ExpressionMammalianMutationM467G ; F468G ; P469R ; V476R ; D479V ; L480DAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-gp78 G2BR mt / JM23
Plasmid#13306DepositorInsertgp78 (AMFR Human)
ExpressionMammalianMutationQ579A ; R580A ; M581A ; L582G ; V583G ; Q584GAvailable SinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-H741A
Plasmid#238335PurposeproUBI10::VIH2-FL::FLAG-H741A ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-C696A
Plasmid#238336PurposeproUBI10::VIH2-FL::FLAG-C696A ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-K219A-D292A
Plasmid#238331PurposeproUBI10::VIH2-FL::FLAG-K219A-D292A ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-R372A-H373A
Plasmid#238332PurposeproUBI10::VIH2-FL::FLAG-R372A-H373A ubiquitous expression in Arabidopsis plantsDepositorInsertVIP1 (VIP1 Mustard Weed)
Tags3x Flag-tagExpressionPlantMutationAtVIH2-AtVIH2-R372A-H373AAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
proUBI10::VIH2-FL::FLAG-Wild type
Plasmid#238330PurposeproUBI10::VIH2-FL::FLAG-Wild type ubiquitous expression in Arabidopsis plantsDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-2xFLAG-2xSTREP-E2F2
Plasmid#236434Purposedoxycycline inducible expression of E2F2 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
NLS-Cherry-PCNA-P2A-Venus-E2F2
Plasmid#236447Purposeinsect expression of E2F2 for protein purificationDepositorInsertE2F2 (E2F2 Human)
ExpressionInsectAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR2
Plasmid#176245PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only