We narrowed to 27,824 results for: gfp
-
Plasmid#32481PurposeCre-dependent expression of PSAM-GlyR (L141F,Y115F) neuronal inhibitor, with IRES-EGFP markerDepositorInsertPSAML141F,Y115F-GlyR
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsIRES-EGFPPromoterSynapsinAvailable sinceJan. 13, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-centrin-1
Plasmid#72641PurposeThe plasmid encodes centrin-1 with an N-terminal EGFP tagDepositorAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MuHKII-pGFPN3
Plasmid#21922DepositorInsertMutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKII cDNA sequence …Available sinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N1-PHD2
Plasmid#21401DepositorAvailable sinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRK5-EGFP-Tau AP P301L
Plasmid#46906Purposeexpresses EGFP tagged Tau AP P301L in mammalian cellsDepositorInsertTau AP P301L (MAPT Human)
TagsEGFPExpressionMammalianMutationP301L AND all 14 S/P or T/P amino acid residues (…PromoterCMVAvailable sinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
tdp43-EGFP construct4
Plasmid#28197DepositorPublicationInsertTar DNA binding protein (TARDBP Human)
TagsEGFPExpressionMammalianMutationaa216-414 onlyAvailable sinceSept. 8, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRK5-EGFP-Tau E14 P301L
Plasmid#46909Purposeexpresses EGFP tagged Tau E14 P301L in mammalian cellsDepositorInsertTau E14 P301L (MAPT Human)
TagsEGFPExpressionMammalianMutationP301L AND all 14 S/P or T/P amino acid residues (…PromoterCMVAvailable sinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRU1156
Plasmid#14473DepositorInsertGfp-mut3.1-GusA
ExpressionBacterialAvailable sinceApril 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
K44A dynamin 2 pEGFP
Plasmid#34687DepositorAvailable sinceFeb. 16, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N1-VAPA(1-242)
Plasmid#18874DepositorAvailable sinceSept. 19, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EGFP-BRCA1
Plasmid#115491PurposeEGFP-BRCA1 expression vector. Parton clone BXYDepositorAvailable sinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EGFP-Tubulin.K40Q
Plasmid#32912DepositorAvailable sinceNov. 18, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEX.d14GFP.sEF1a.Kozak.HA.NLS.Sce.T2A.BFP
Plasmid#45564PurposeExpresses I-Sce I nuclease and BFP tracker in mammalian cells, codes for eGFP donor sequenceDepositorPublicationInsertsd14 eGFP donor
I-Sce I Nuclease
BFP
TagsHAExpressionMammalianMutationdeleted n' 15 amino acidsAvailable sinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
5'UTR CGG 99x FMR1-EGFP
Plasmid#63091PurposeContains expanded CGG repeats (99 repeats) within the 5'UTR of FMR1 as found in the Fragile X Tremor Ataxia Syndrome (FXTAS). These repeats are in frame with EGFP.DepositorInsertexpanded CGG repeats (99 repeats) within the 5'UTR of FMR1 (FMR1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Str-KDEL_SBP-EGFP-GPI
Plasmid#65294Purposesynchronize trafficking of EGFP-GPI from the ER (RUSH system)DepositorInsertGPI anchor
TagsEGFP and IL-2 Signal Sequence and Streptavidin Bi…ExpressionMammalianPromoterCMVAvailable sinceJune 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-blast shGFP
Plasmid#110419PurposeshGFP control, silence GFP gene, blasticidin selection.DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA PolIII)Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-N1_MeCP2(WT)
Plasmid#110186PurposeExpression of mouse MeCP2 (WT) in mammalian cellsDepositorInsertMeCP2_e2 FL (mouse cDNA) (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationwild typePromoterCMVAvailable sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP rbFOX1
Plasmid#63085PurposeMammalian expression of EGFP tagged FOX1DepositorAvailable sinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pegfp-N1-TFEB-S3A,R4A
Plasmid#44446DepositorInsertTFEB (TFEB Human)
TagsGFPExpressionMammalianMutationChanged both Serine 3 and Arginine 4 to AlaninePromoterCMVAvailable sinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by